Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhgc10c14
Contig Information
Length 708 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhgc10c14   
Homology (BLAST) Top Hit hypothetical protein OsI_33681 [Oryza sativa Indica Group]
Score 349
Evalue 2.66782e-31
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhgc10c14
TTACATGTAAAAGAGAAAACTGAAAAAAAATACATGTATACCAATGTAAGATCTTACGGATATAGCATCGACTGAGATTTAAAGTCTGATCAGTCGACTG
AGACTTAACAAGATTGATATAAAAATATGCAAGAGTACCTAATTAACTTATCTGACTTAGCGAGAATAGCTAATTTAACTAGCTAGGAAGCAAGCTGCAC
GTATCCATCAGGTTCACGTGAAGCTCCAGCACCCAAGCTGGGTTCTCTTGAGCTCCTCAAAACCCTCGGTCGCCATGAATGATAATAGGTTACCGGGGAT
CGAGAGGAACTCCATGCACGCCTTCTTCAGGACGGCACCTCCGTGCCGCTCCGCCAACGCCAGCATGGTGCCCACGGAGCCCATGTTGACGCGCGGGCAC
AGCGCCTCCTCGCAGACGACCTTTATCTTCTCCAGCCCGTACCTGTCCGCCGCCACGAGCAGCCGCTCCGCCGTCGCGGCGTCTGCCTCGAGCTGGTTCT
TGTCAGGCAGCACGCTCGTGTACATGAACTGCAGCAGGGTCTTGAACACCTGGGCGTCCATGTCGTCGACGCGTACCTCGCCGGTGCCGTTGTTCTCGAG
GTCCGCCTTGAAGACGGCGGACGCANCCTCCNGCACCGACCGGTGCGCCGGGAACGTCTCGTCNCCNACGTGGATCGTCNCGTCCGTCTCNNTCCANNTG
GNCTCCCC
page-top