Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhgc4d13
Contig Information
Length 702 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhgc4d13   
Homology (BLAST) Top Hit hypothetical protein OsI_09579 [Oryza sativa Indica Group]
Score 519
Evalue 5.07199e-51
Total Hit Count 117
Registered year 2003
Contig Sequence     [ Download ]
>rwhgc4d13
GTAAGTAGTAAACACACAGACGCAAACTTGAATACAAACTCTTTTACTAACTACAACACACACATGGATGAATGAATCCCAGCCAAATAATGTACCTCTG
TGAATACATCTCTACACCGCGCGCTCTTCTTCCCTTACTCTCTTACTCTACTCTATCCCCTCCTCGACTGTCGACGGACGGCGAAACCCCTCGAGACCTC
GGCTCGAGGGCGAAATAAACACCCGTCGTCCATCCATCATAAAAGGAAAAAATATCCTTGCCAACAGTGCATTGAATTTGCACCCATCATTCAATGTTTT
GCTACATCAGGGTGTCACCTTCCCCACGTCGACACATTTCCCAACCTTGGCAACGCTAAGCTAAACGCCGAGTTGGCGAAGAGAGTCGGGGCCCACCAGG
TATATCCGTCTTTGGCTGCTCTTGTACCGGAACACCACCACGCCTTTGTAAGCCGCCCGTGGAACACCGTCCTTCCACTCTTCAAATATTCCAAACTGAC
GAGCTATACGCTCGAAGTCGCCCTGATTGTCATACTGAATCCTTACGTCCACATCCAGATTGTGGGCCTTCAACAAAGCATCGGATCCATGCACAGGTGT
GGCGCTAGCCACGTCTTTCCCGAATTTGGTCAAAAACTTGTCCTCCTTGAGGTAGCTCAGGTCCTCGGAATTCCAGTCAATATGAGCATCATTTAACTTG
AT
page-top