Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhgc10d03
Contig Information
Length 677 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhgc10d03   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 78
Evalue 0.69725
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>rwhgc10d03
ATTAGCACATATATGACTAATGACAAGAAAGTTAGCCACAATTGTCATATCATTGCTCCTGCTCCAAACTTTTCTGACAGCCCAACAACGAGGTACAAAC
TGAAATTAGGATCGTGGGGTTAAGATCGTTGATCTTCTCGATAGCCTTCCGAGCATTTCCCTAACTTGCCCACTTGCTTCACCTCCATCCGGTTGGTGAT
GGTCCACCAGGTAAATGTGAACTCATCCATGCTGTCATTGCATAGTTCATCCGGCAACTATTAGTCGAGATCAGCATCCAGAACATCACCCTTCTTGATC
TCTTGTAGATCGACGAACGACACGCAACGGCGGTGCGCCACCGAGATCCCTTCCAAAAGGGCCTCCAGCGAGATTCCCTTGTTCACCCGCCACAATATAG
GTACGAGGCGAAAAGGCGGCGGCGGCATGCGTACAAGCTGCGTGATAAACTGCTCCTAATCGATGGCGCCGCCTCCTCGCAGCGCCTTCTTCTTCTTCTT
GGCTGTCTCTCACAGCTCAACCTTCTCTCTTGTGGTTTCTCTCAAGCACACACCATGGAAGAAATTCTCAGAAAACACACACACCCACGCATGGACCAAG
GAAGAAGGAGGCAATAGCTTTGCCAAGAGACACCTTCCTCTTGGTCAGCCGTGGCTACNTCTTTTTCTTTTTTTTTT
page-top