Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhgc10d06
Contig Information
Length 765 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhgc10d06   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 589
Evalue 4.56768e-59
Total Hit Count 83
Registered year 2003
Contig Sequence     [ Download ]
>rwhgc10d06
TGTCACATGCTACACTCAGATCATGTTCCAGAGGCAGTAAGACAGGCCTACCTCATCATCTAGCAAAGTACAGCAGCTCAAATTTCGTGCGAGTGAGAGG
GATTGTTCAGATAACTTCTAGGGACTAGTGATCATCTAGTAACGCACAACAGGCGGTAGAATTACATTTCGCTCAAGATTAAAATGGCCGCGCAACAAAA
CGTAACACAGCCTGCTAGTGCTTTGTTCAATCACGAGCCCTAGGAAAAGTTAGTTAAAGGCATTCTCATGTCTTCAGCTCAGGAGGCCGAAAGCGGGATC
GGTCTCACCGCACCCTGTATGCGCCGGAACGCGGTCTTGATCCTCTCTTTCAGCCCAGCATTCTCGCACTCCACATCACCGCTCCTGCCATCCAAGTGCG
CGACGTCTCCNTCCACAGTTATGACAAGCTTCCCTTCCTCTGCAACTTTAACGTCGCCGAAGAGTGATACCATCAGAGAGTACACCACCTTCCGCGCCAC
CTTCTCTGTTTCTTCTTCCGTCTTCACCGCTTCTTCGATCGGAACAACCTTCGGACCCTCACGGCCAATGTTCAAGATCATGGCCACCACCGAGTCGGAC
ACCATGTCGCTTATGGGATCGGACGACCACTGCAGCGTCACGTAGCTCTCTGAATCCAGGCGGATGGCCACTCTCTCGTGAACAGTCAGTACTGGAACAT
CTTCTTCGGNTGATGATTCCACGCTCTCGTATATTTGCTTCAGTCTGTACTTGACCACCTCAAAG
page-top