Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhgc10d19
Contig Information
Length 770 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhgc10d19   
Homology (BLAST) Top Hit beclin1-like protein [Triticum aestivum]
Score 742
Evalue 8.42158e-77
Total Hit Count 184
Registered year 2003
Contig Sequence     [ Download ]
>rwhgc10d19
CTGATCTAAACGATCTATTTCTTTACAGAGGGAGTACATATTAATGGAACTCACTCCAGTCCATATTCATATACATTGGGCAGGTACACACATGGATGAC
TTGGAAGCAACAAGAAAACTAGCTATGCCTGGTATTTATGTACATCAATTTCATATTGTTGTGATTGGTCAACATGCGGCTACAATCAACGATCCAGCTT
CTGAGGTCAGTGATTCCGTCTGCATTTAAACATCACATCAACCCTTCTTGTTTGGAGACTGCGCCAAGTACAAAGATGCAGATGGCGGCGCGAAACTTGT
ATTGCCGATAAACCAGTAGAGAACCCACTTCAGGTTGCAAAGCATATATTTTAGAGCCTTTGTCCAGTTCTCCAGTTTATTAAAACTTAAGAAGATTGTG
TAGCTCCCTACTTTGTCACCATCAATCTTGTAGGGGAGCTTCAATGACTTATCAGATGGAACATTGTTCTCTTTATCCAAACTTATGGCAAACTCGGAGA
ACTCTTGCAGGCAAGTGAGAAACCATGTCATGGCTTTGTCAAACCGGGTGCTCCAGAATAAATTTACAGGACCAAACAGTTCATAGGTATTATTGTTGAT
GTCTGTTACTCTTGGGTAGCTTCCCATAGGGTGAATCTTGATTCGATATCTGCATATAAGCTCAGGAACTCACAGCAAAATCATCTCTTCTTGGAACAAT
TCTAGTGTACGTAAGAATTACTAAAACTTATCACTTAAGCAACTTAGCAATACAAGAATGGGCACTTGTT
page-top