Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhgc10f05
Contig Information
Length 705 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhgc10f05   
Homology (BLAST) Top Hit hypothetical protein OsJ_002579 [Oryza sativa (japonica cultivar-group)]
Score 506
Evalue 1.6316e-49
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>rwhgc10f05
GGAGGTGATATCATGTCCAGTCCAGTAACAAGGTTACACACCATCTAAACCACCATAACCCTGAAGAAATTAGCCGCTTCACAAGATGACTGAATGAAAT
GTATAGTAATGTACAGTGCTAGTGACTTCACCCACCAAAAGAAATCCCAAAAAAATACAACTCTGGTGTCTTTTCCCTGCAGAATCTAATGGTCTGATGG
TACTTGCATGACACTGGGAGGCGAACGGCGAATTTCACCTGCTCCAAGCTTCTGATAAAAAGATGTACCGGAAGGCTTTGCTTGGAGTTTAAAGTAGTGG
ATTGCAGAGATATTGTGCAGAGCCAGAAAAGCTGGAGGCAGGTGCATCACCGAGAAGGAAAATGCCCACGATCAAGAATGCCCAAATTGGGACAATACTG
ATTGAAACAAGGTAGAAAATGCCTCAGCAGTAGTCCCATCCTCGGCCTTGATTTTGAGCTGGGCCTTCGCTGATGCTGTGTTAACAATGCATTCTACAAG
GTAGAAAGCAGCAGCCCCAGCTTTCTGACCATAAAAGTAGAACTTGTAGTTTGGAGGCTGACCGCCTGAAGCAATGCATTGAATGTAGTTGCTTTGCATA
TGACGAATGAGCGATTGGGGATTCATCAAAGAAGCTGCTCCTTGTGGACTTAAAGAGCATTCCTGAGAAAAGGATAATGCCAGTTGGCCCCATTTCTTCT
GGAAA
page-top