Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig6
Contig Information
Length 472 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 1 Clones [Download: CSV  ,  FASTA ]
whfl45o17   
Homology (BLAST) Top Hit ribosomal protein S8 [Hordeum vulgare subsp. vulgare]
Score 550
Evalue 5.02627e-55
Total Hit Count 393
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig6
tcatcgctgtctggaacaactcgagaaccgaaaacggtggcgagaccaaaccaaagctgcggcggcgcgcaggcgaatcagcagcggagccaagcaaccg
acgccaccatgggtatctcgcgtgactccatgcacaagcgccgggccaccggtgggaagcagaaggcttggaggaagaagcgaaagtatgagctcggccg
ccagccagccaacactaagctttcgagcaacaagacagtgaggagggtccgtgttcgcggaggtaacgtgaagtggagggctctccgtcttgacactggt
aacttctcatggggtgaggctgtgacccgcaagacccgtctcctggatgtggtttacaattcgtcgaacaatgagcttgtgaggactcagacccttgtca
agaatgccattgtgcaagttgatgcagcccctttcaaacagtggtacctgactcattatggagttgaaatcg
page-top