Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whgc10f20
Contig Information
Length 164 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whgc10f20   
Homology (BLAST) Top Hit Os08g0558200 [Oryza sativa (japonica cultivar-group)] >gi|42407953|dbj|BAD09092.1| putative auxin-regulated protein [Oryza sativa Japonica Group] >gi|45736096|dbj|BAD13127.1| putative auxin-regulated protein [Oryza sativa Japonica Group] >gi|113624461|dbj|BAF24406.1| Os08g0558200 [Oryza sativa (japonica cultivar-group)] >gi|125562545|gb|EAZ07993.1| hypothetical protein OsI_30255 [Oryza sativa Indica Group] >gi|125604318|gb|EAZ43643.1| hypothetical protein OsJ_027126 [Oryza sativa (japonica cultivar-group)] >gi|215697598|dbj|BAG91592.1| unnamed protein product [Oryza sativa Japonica Group] (no hit)
Score 769
Evalue 4.92026e-80
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whgc10f20
AATATCATATGTACCCTGTAGCAAACTTGCCCCTGATGATGTTATGTAGAGATTTAAATCTTGTGCAGTCGTGTTTACCTCCTGTTACTAAGAACCTAGT
CTAAACTAGAAACAAAATGGTGCAAGTTGAAACTTTAAAATTATATAAAACTTCAAAAAAAAAA
page-top