Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whgc10f05
Contig Information
Length 701 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whgc10f05   
Homology (BLAST) Top Hit adaptin N terminal region family protein [Zea mays]
Score 967
Evalue 5.65422e-103
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whgc10f05
ACGGCGCCTTCGCCGGCGAAGTCCGCCTCCCCGTCCCAACCATCCGGCAAGAGCGAGGTGTCGGATCTGAAGCAGCAGCTGCGGCAGCTGGCGGGGAGCC
GTGCGCCAGACGCTGATGATCAGCGCCGGGATGTCTTCAAGCGGGTGATCTCTTGCATGACCGCAGGTATCGACGTGTCGGCGGCGTTCGGGGAGATGGT
GCTCTGCTCCGCCACCTCCGACGTCGTGCTCAAGAAGATGTGCTACCTCTACGTCGGTGTCCATGCGCGCGCCCACCCGGACCTCGCCCTCCTCACCATC
AACTTCCTCCAGCGCGACTGCCGCGACCAGGACCCAACCATCCGCGGCCTTGCGCTCCGCAGCCTCTGCTCCCTCCGCGTTCCAAACCTTGTCGAGTACC
TTGTTACGCCGCTCACCACAGGGCTGAAGGACCCTAGTGCCTACGTTCGGATGGTCGCTGCTGTTGGTGCTGCAAAGCTGTATCACATATCTGCTACCAC
CTGCCTCGACGCTGACCTGCCTGCTGCGCTCAAGGCACTTATGCTCTCGGACCCTGATGCCCAGGTGGTTGCCAATTGCTTGCATTCACTGCTTGAGATA
TGGACCCTAGAAGCTGCCAATTCAGAGGCAGCAGGGANGGAGATTGAGACACTATATAGCAAGCCAGTGGTGTTTTACTTGCTAAACAAAATCAAAGAAT
T
page-top