Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whgc10b07
Contig Information
Length 674 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whgc10b07   
Homology (BLAST) Top Hit hypothetical protein OsJ_006744 [Oryza sativa (japonica cultivar-group)]
Score 979
Evalue 2.12546e-104
Total Hit Count 342
Registered year 2003
Contig Sequence     [ Download ]
>whgc10b07
TGCTTCCAGTTTCCATTTGTCCAGATATATGTCGCTGGAGTGCAGGCTCCGTCCATGGGGAGACGACCACCGAATCCTACTGTTGTTGCCGAACCAGAGG
GCACTACTAACGGCACTACAAATGGTGACGATTCTGGGGAAGCTCCTGCACCACTGACAACAGCACAAAGGCTTGCTGCATCGACAGCCTCTACTGAAGT
TCCACCAGATAGGTTTGGAAGAGAAGCTAAGCATTTCACAGAGACTCGTGTTCTGAACAGAGATGTGCGGATTGTGGTGGAGGGGACAGACAGTTTCAGT
AATATAATTGGTTCGGTGTATTACCCAGATGGTGACACTGCTAAGGACTTGTCCCTTGAGCTTGTTGAAAATGGTCTTGCGAAATATGTGGAATGGAGTG
CGAACATGCTAGATGTTGAAGTTAAAATAAAGCTGAAGAATGCTGAACTTCAGGCAAAAAAGGAACAGCTGAGAATTTGGACTGGATTTAAGCCACCAGT
GACAAATTCGAAGCCAATCCATGATCAGAAATTCACTGGAAAAGTGGTAGAAGTTGTGAGTGGAGATTGTATTATTGTTGCTGATGATGCTGCTCCTTAT
GGTAGTCCTTCAGCAGAACGGCGGGTTAATCTTTCAAGTATTAGAGCTCCTAAGCTAGGCAATCCCCGCAGAGA
page-top