Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whgc10e05
Contig Information
Length 698 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whgc10e05   
Homology (BLAST) Top Hit hypothetical protein OsI_33191 [Oryza sativa Indica Group]
Score 871
Evalue 2.89957e-92
Total Hit Count 440
Registered year 2003
Contig Sequence     [ Download ]
>whgc10e05
GCGACACCCACTACTCGCTGTCANCATGGATTGCAAGTGTCGAGCCGGGACGGCCCATGTGAGGGCGGTGGTCAAGGCCCCCAACGGCGAGAACATCACC
GCCGGCGGCATCGACGCCCAGTCCGGCTGCTGGACCATGCTCAAGGGCGGTATGACCGCGCACACCTATCACTCTGGACAAGGAGAGGTCTTCTTCCAGA
GCGACACGCCCGTGGACATCTGGGTGGATAGTGTTTCCCTGCAGCCCTTCTCCTTTGATGAATGGGACGCCCACGCCCGCCGGTCCGCCGATAAGGCTCG
CCGGAGCATGGTTAAGGTCGTCGCGAGGGGCCCCGACGGGCAGCCAATGGCGAACACAAACGTGAGCATCCAGCTCCTCCGCACAGGGTTCCCGTTCGGC
AACACGATGACCAAGGAGATCATCAGCAACCCGGCCTACGAGAAGTGGTTCTTCTCGCGCTTCACGGTGGCCACCATGGAGAACGAGATGAAGTGGTACA
GCACGGAGTGGAACCAGAACCAAGAGGACTACAAAATCCCGGACGACATGCTCAAGATGGCTCAGAAGTACGGCGTCAAGGTGCGCGGGCACAACGTGTT
CTGGGACGACCAGAACTCGCAGATCAAGTGGGTGCGGCCGATGGGCGTCGACCAGCTCAAGGCGGCGATGCANAAGCGGCTCAAGTCGGTGGTGTCGC
page-top