Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whgc10d19
Contig Information
Length 714 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whgc10d19   
Homology (BLAST) Top Hit beclin 1 protein [Triticum aestivum]
Score 715
Evalue 9.77571e-74
Total Hit Count 39
Registered year 2003
Contig Sequence     [ Download ]
>whgc10d19
GTGGAGTCCAGGTCGGACTCACCGCGCCTCCGATTCGATCCCCCCACGCCGGGGTTCAGCAGGAATCCTAAGCTTGGAAGGGCGGAGGAATCCTGCACAC
ACATAGCTCCGGAATCCCGCAAGCGCGAGAACGCCCGGAGCTAAACCCGAGTTACTGCTGCGACATGAAGCCCAAGGTTGCCGCAGCCGCTGCCGGCGGC
GAGAAGGGCCGGGGAGTGGACCCGTCGCTGCCGCGGTTCAAGTGCCAGGAATGCCACCGGGCGCTCGTCGTCGTCGGCGTGGAGTCATTCCCCGATAGGT
TGCCCGCTCACGCCAACTCCGGTATACATGCATCCTCTGTTCAGGGCAGCATTATGGGGGCGAGCAGGATGGACAGTTCTTACGTTGTGTTGTCCAAGCA
GAACAGATCTCAAGGCCCCAGGATTCCCCCACGGCCACCTAGTGCAGCAGCCCGGCATGTTGAGCCTAACCAATCAACAAGAGCAATAGAGGGGTCATAT
ATAATGCTTCCACCTGCCGCTGCTTCCATATACAAGACATCTACCTCCGAAGGAGGTGGCGCGCATCTGTCGCCTCCAAATGTTAACTCTACTAGCCCTT
CACCAGGCAACAATTCTGGATTTCACTCTAGTGTGACTGTCTTAAAGCGGGCATTTGAGATTGCTAGTTCACAAACTCAGGTTGAGCAGCCACTCTGTCT
GGAATGCATGAGGG
page-top