Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whgc10c14
Contig Information
Length 683 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whgc10c14   
Homology (BLAST) Top Hit hypothetical protein OsI_06914 [Oryza sativa Indica Group]
Score 222
Evalue 1.31905e-16
Total Hit Count 311
Registered year 2003
Contig Sequence     [ Download ]
>whgc10c14
TAGTGTGTCCGTGAGCTTCTCTCTTCATGTGCGTGTGTGTGTAAGCAGCACTAGTGAGTGTGTGTGCTTTGCTAGTGTGCTGAGCGCAGGCAGTAGTAGC
ACTTGGCTCTTCCGCCGGTCGTGTATCAGTGTACTCGAGTGCTAGCAAGTAGTTCTGGGCTAACAGAAGGCAGCCGATCACCGGCTCCCACGTCCTCTAG
ATCCACGGCTACNAGCAGATCAAGAAGATGGTCCCCAACGGCAAGGCAGTCGAGTCAGCCCCGTTCGACGTCGCCGGCCGCGCCTGCCGAATCAGGTGCT
ATCCGAACGGCAGCGGCAAGAAACACTACGGCTACACGTCCCTCTTCCTCACCAGCCACTGCGACGACGGCACGGTAAGGCTAGAGCTCAGCGTGCTCGA
TCGGGACGGGAATCCGTCTCGCACTCGAGCCACGGAAAAGCGGCGCTTCTGGATCGGCGACAGCTGGGGCTGGGGCTTTAAGGATTTCGTGAAGAACGAC
GATCTGGTCGAGGGAGAGCACCTCGTGGACGACTGCCTCATCGTCCTCTGCGACGTCACCGTCCACGACCCTTCCTTGCACGCCGAGGAGGTTGCCGCGC
CGGTTGTGGCGCCTCCGTTCGACCTAAGTGGGGAGCTCGGGGAGGCCATGTGGAACGANACGGACGTGACGATCCACGTCGGC
page-top