Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whei16e16
Contig Information
Length 575 bp
Tissue Dormant seed with water absorption after breaking
Clones 1 Clones [Download: CSV  ,  FASTA ]
whei16e16   
Homology (BLAST) Top Hit Os02g0772000 [Oryza sativa (japonica cultivar-group)] >gi|113537793|dbj|BAF10176.1| Os02g0772000 [Oryza sativa (japonica cultivar-group)]
Score 548
Evalue 1.39268e-54
Total Hit Count 134
Registered year 2003
Contig Sequence     [ Download ]
>whei16e16
ACTTGTCATTTGGGGTTATTATAAGAGTGGAAACTGAAGCATTCCAGGTTCTGAAAGGAGTGCCAGATAGACCTGAAGTGGTGCTTGTAAAATTAAGAGA
AATAAAAAGCAAGATTGATCGGCGTACATCAGCGAAAGATAAGTTTAATAATATGGTCGCAACCAAGGATGTTGTCAGAGTTGTTGAGGGAGCATGTAAG
GGAACACAAGGACCTGTGGAACACATACATAAGGGGATATTGTTCATATATGATAGGCACCACCTTGAACATGCAGGCTTCATTTGTGCAAAAGCACAAT
CGTGCATTCTTGTCGGTGGATCGACTGGTGGCCGTCGTGGAAATGGTATGGATGCTGCAGATGCTAGGATGGGTGCTTTGAGATCCCCGGCAAGCATTTT
GCAGTCTCCAGGAAGGCTGCCCCCAAGAGGACCACAAATGAACTATGGTGGAAGATTTGGAGGAGGTGGTCGTGGTGGAANANGACATGACNCCTTGGTT
GGCNNNTGTATCNNAATTANATCTGGTCCTTACNNNNGGTACCGNGNCCNCNNTNNNNAGNNACTGNNNNGCTTG
page-top