Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhei14h19
Contig Information
Length 698 bp
Tissue Dormant seed with water absorption after breaking
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhei14h19   
Homology (BLAST) Top Hit hypothetical protein OsI_27446 [Oryza sativa Indica Group]
Score 412
Evalue 1.27064e-38
Total Hit Count 95
Registered year 2003
Contig Sequence     [ Download ]
>rwhei14h19
AATTCAGAACTTTTTTGACAACAAGCCTTGGTTTAATGTTCTACATACCACTTTAGTGGACTGGAATTACAGGTTACCAAAACAAAAGAACAGCAGGGCT
CAGCAACAACTTTCTCCTACCACTATTTTCAAATTCTTAGCGTAATAAATGTTTTATACAAATCGCGCAGCAGCTGAACACTGCTTCGCCACATGGTCTT
GCCATGCCATCTTTCCCGGTACTACATTAATGCAGGCAGCACTTCGTCGCCTGCCAAATGCCTCCATTCTGTTCCAGCAAATACAGAGAAGGCCAGCACT
GCTGCGGGGGAAATGTCAACTGGCGGCGGAGGATTCCTGAGTTACTTCCGTCGTGGCCTCTGCGGCGGAGCTGCTGGTCTCCGCGGCCTGGTTCTGGCTG
CTCTGTGCCTCAGGTGCGGGCTGCTGCTGTTGATCTTCGGCGAGACCCAGAACCACCAAGATAGATCTCGGGAGAGTTGATCGCACGTTTGGCTGGCTGG
CATGCTCGACCAAGGGCGCCTTCAGTAGAGGGTTCTTATTCAGGGCATTTTCGAGTTGTGGAGCTGGTAACTGCAGTAACACACCATAGGACTGAGGTTT
TATCAGGATAGCACACTTCAGGAATCCTACCCATAACTTCGGATATTTCCATATCTGCTTGTTAACAAGGCGTGACATGATCTCCATCACAAAATCCA
page-top