Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig194
Contig Information
Length 894 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10a17    rwhdp10a17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative ribosomal protein S18 [Triticum aestivum]
Score 173
Evalue 1.05202e-10
Total Hit Count 232
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig194
AGCTGCCGCCCTATCCCTCCCTTAGATCTCGATCCACCGCTGCCCCCAAACCCACCCCCCGTCGACGACCCTCACCGTAGACGTGGTGCTGTGGCGCCAA
GGCCGGGCCGACCTAAGCGCCTTACTCCTAGCGACTGCCGTCGCCGCGGCCAGGAGAGTCTCGCTCCGCGAGGCCGCACTCGCGACCTGCTACCCCGCGC
GCGCGCCAACTCCAGTAGTTGGCTCGCTCGCTTGCTGTTGTAGGTGAGTGCTGGGTGGAGCTTGAATCGGGGAGGAGGAAGGCTGCAGATCCGGCGGGCG
AGGAGGCAAGCCGTGGGTTGCAAGAAGGCGGTGGTGGTGTGCGCGCTCATCGGCTTCCTCGGCGTCCTCTTCGTCGTGCTTGGCTTCGCCGCCAAGGGCA
CCCGCGTCAAGGCGATTCCGACATCATCAACGCAACACCAGCTGTACAAAGTAACTAAAAATTCCCAGGTGTCGGACTGTTTCCTGAACAGGAAGAAGGA
CTACAAGGACGGGACGTTCTCCTAGGTCGTCTCCAATGCCATCGATATGAAGCTCAGGGATGACCTTGAGAGGCTCAAGAAGATCAGGGAGCTCTGCATC
CGAGTCTCATCCATCCTCGGCAGGAAGGAGCTGGGCCAAGGGAGCAAGCAGCACTTCTGGTTACTTGGGGCCAGATCGAGTAAGATGGCGCACCATGGCG
TGTGGCGGCCTATTTTGCTTCCAAGAGCAGTACTGTTTATTTGAAATGAGATGTACTCGTATACTGCCTAGTAAAATTGAATGATTGCCATGTACTATCT
ATGATGTAGTGAGCTGTAGGAGTGAAATGAAATTTTATTTGTTGTTGTATGTGTTATTTTCCTGTAATGTGCTGTGTACATTTACTGAATATAA
page-top