Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhei1a21
Contig Information
Length 670 bp
Tissue Dormant seed with water absorption after breaking
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhei1a21   
Homology (BLAST) Top Hit hypothetical protein RG210_02566 [Phaeobacter gallaeciensis 2.10] >gi|161383144|gb|EDQ07536.1| hypothetical protein RG210_02566 [Phaeobacter gallaeciensis 2.10]
Score 81
Evalue 2.80003
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>rwhei1a21
CTCATTTGCTATTCAACCACAGCGAGGATGCTAATTTTTGTCTAGCCCTAAACTTCAGTTGAAGTCAGGACTGAACGCGTCATCTTGCTGGCCTCCTTCT
CCTGTCATGGTGGCCGTGTCCTCCTGCTGACATGACTCACGGCAGATCCATAGTACATGTCGTGGCCTGCGACATCATAGACGTCGAAAGATACAAGGTG
GAGGAGCAATTGTTCTCATCAACGAGGTTTAATGTTTATGTGCTGCAAGCCAGAAGAAGAACCACCATGGTCGCCCTTGGAGGCGACGGTGTCAGATTCC
GCCATGGCCACTCCCAACCTTCTCCACTCTGAGATGCCGATTANACTGCTGCAGCACGACCCGTGGCTGCCGCGGCTGTTACTCCGGCCCGATCCGGTTA
TGGGAGGGAGAGGACGCGTTGGGCGCGCGGCGGAGATGGTTACCGTTCCGTCCGCTCCAGTGAGCGTCGAGCCGGCGAACTGGCCGCTAATCCAATCGCG
TAGAGGACAGTGTTCCGGTCGCTCGACCATGAAAAATTCATGATCTAATCGCCGCTGCACCGAAAAAGCAGAAGCTACCCGTATCTGTTCGGAATCAATC
ACTGCGTAATTGACGGAAGCCAGGATCGCACGTAGATGGGCAGTTTTGGAGCCGAACGTAAGGGCGCTTG
page-top