Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhei1c12
Contig Information
Length 726 bp
Tissue Dormant seed with water absorption after breaking
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhei1c12   
Homology (BLAST) Top Hit hypothetical protein OsI_19641 [Oryza sativa Indica Group]
Score 687
Evalue 1.79069e-70
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhei1c12
ATGTTTCAGGGACTCATACAGGATCATAACCATCATCGCCGACATCAAAACAAACTCTTGAAACTGATTGTATGCCTTAATAGTTCTGGAACGAGATACG
CAAAGCCCATCACATAAAATTGGAGCAAAACTTCAGGTGAAAGAACGGGTAATGATGTGGAGTGAGTCAGCATAGGATGCACAATTGCTTGGTGGGTTGG
TTGGTTCACTCGTCCTTCTCCGCCAGCGCAGCCTTGCGGCTGCTCCTCTCAGCGAGGACCGACTTGGTCTTCTCCAGCACGCCGAAGAAGATGGACCCGC
CGATGCCGATCCACAGAACTCGCGGCTCGATGCCCTTCAAAAAGGCGCCGGGACCTTCCTCCCTCAAGATCGTCTTAGCACAGCTTACAATTCCAGAGTA
TTGCTTTGTTTGCCCCTGAACCATCAACCTTGTCTTCAGAACATCGAGGGGGGTTGTTATAGCACCAGTAATCGCACCGGCAAAGGCGCCAATTAGTGCA
TTCTCTGGATCCTTCAGCTCCCTCTTTGCCATAAGCTTGTAACCAATTCGAAGTTGCTCGTATATGCAGAATTGAATGGCATCAAACGGAAGATCTCGAA
GTAAAAATGAACCATAACCAGCAAAAAGCCCTCTAAATCCTTCCTTTGCAACTATGAGACGAACAGCATCAGGCGCAGTCCTGAATTGACCAGTTTGCAT
TCTTTGTTTGACCACCTCTGTGGGGA
page-top