Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhei1d20
Contig Information
Length 707 bp
Tissue Dormant seed with water absorption after breaking
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhei1d20   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 400
Evalue 1.17519e-38
Total Hit Count 73
Registered year 2003
Contig Sequence     [ Download ]
>rwhei1d20
ATATTGGGCAAATTAGACCANATTTTGGAAATCAATGACCGTTTTACATACGCGCAGGCATTATATATAAACCGAAAGAGAGATAGCATATGGCGTTGAC
ACTTTTCGTCAACAACGTCACTTGNCGGCCATTGCTACCATGAAGCTCCATTACATCACTGAAATAANACCCGACCGCCTCNTTGAGCCACCNAGCGGAA
TTCCAAAAGGAACAGGATGATAGCGGAGTTGGTGCGCACAGGAGGTGATGATCTCGTCAACAAGCACCACAGATCCATAAATGTAAGGACGAGAATCATG
TCGGCGCGCAAACTTTCGCCGCTCTGCTTGGACTCAAGGGTTTATAAATTAACCGTGCAACATCANNAAACGAGTGAATCCTCCTCGTCGCGCGGGTTCT
CGAGGGCGGTGACGTGCTCCTTGAAACGAGCCGCGGCTTCCTCCCTCTCATATTCCTTGCCCAGGTGGTTATACGTCATCGCCTTGAGATAGTACACCTC
TGCCGCCATCTCGTGGTACTCTAAAACCTGCAGGTCTTCAGCCGCTTGATTTANAGGGTCCAGAACNGCACAAGGATCTTCAGAAACTGAAAATTCTGGA
TCGGTTAAGTGACATTTTGCTAAGACTATCTGAGACCGAGCACGCAGCTCAAGACCGCCATGGGCCGAGAATCATAGGAAGGCTTNGATAAACAAGACTT
AAGGNCC
page-top