Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhei1e07
Contig Information
Length 283 bp
Tissue Dormant seed with water absorption after breaking
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhei1e07   
Homology (BLAST) Top Hit hypothetical protein OsJ_010290 [Oryza sativa (japonica cultivar-group)]
Score 90
Evalue 0.108408
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>rwhei1e07
CATGCCAGTAGTAATTAACATGCCACAACAGTTGTTTTCTGATTGATACCGAAGCATATTAGCAGACTGGACTCCTTTCTCTTATATTTTTCTTAAAGGA
AACACTGGCATATTACCTTCTTAACACGTATGTAGCTCGTTACCACTCTCAAAGCATCGCACGGCTGTAAACGCCACAGTATGAGTGGCAGCTGCGTTTA
TCAACCTTTCCAGGTATCCTTGATGTTCCTGACCGTCCTCAGCGCTTCAACTGCCGACTTGGCACCAAATTTTGCCCTCGTGC
page-top