Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhei1f07
Contig Information
Length 690 bp
Tissue Dormant seed with water absorption after breaking
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhei1f07   
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 575
Evalue 1.57194e-57
Total Hit Count 117
Registered year 2003
Contig Sequence     [ Download ]
>rwhei1f07
CAGTTGTACTAGTTGCTCCCAGTACAATTTACTCCCACACACAAGTTCTCGCCTTATTGCTAGTTGCTACCATCACGCTGCCTCGGCTACACAACTCACA
AGTGCTTAGGTCCTCGGTACAGTTCACACAACTCACATCAGTAGCCAGTAGGAACTCAACTCCATCAACACTTCCCTTAGGTCTCAGCTGAAGCTCATAT
CAGACCTCAGGAAGGCCGTCATCACATCAGGAAGAACGGCGAAGGGAGCAGGGGCCGGACGCTCCTGCGCACGTCCAAGCCCCGGAGGCGCTCCAGGTTC
ATCACCTCGGAGTGGTCGACGAAGAGGTTCACCCGTGGGCCGTATCGTTTGACGAACCACTCAGAGGTGTTGGCACCGGACGTCTCGAACATGGTTCTCT
CGAGCCCGAGCCGGCCGACGATCTTCGCGATGATGTCCGCCCTGAGCGAGTCCGCGCGCTGGCACACGTCGTCGGCATCGATCATGATCATATCCGCACC
TGCCTCCAGGCATCTCTCGGCCCTCCTGATAAGCAGGTCAATGTCTTCGACTCTTTCTGAGCTCTGCTTCACTGGAGCTATGTAAGCCCCAAACGCCCTA
TCACCAGCTGCAGGGATATCAGAGCTGTCGAACTTGACTGAAAACAGGGGCTTGGCTCGCAAGCCAGTGTTCTTTATGAGGCGGACTANT
page-top