Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhei1f20
Contig Information
Length 680 bp
Tissue Dormant seed with water absorption after breaking
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhei1f20   
Homology (BLAST) Top Hit holocarboxylase synthetase [Zea mays]
Score 379
Evalue 8.13902e-35
Total Hit Count 27
Registered year 2003
Contig Sequence     [ Download ]
>rwhei1f20
CAAACACTTGACAACAGAACCGACAGTAATATGCACAGATAAATAAAGTTTTACAATTTTACCCAGAACAGAAAACACAGGTGCACAAAGGCTACACAGT
ATCTTGACAAAGCAACAGGCTGTAAGCAGTAGTGAAAAACATATAAGACATGCTTACTTAGCACAACAGGCTATGGGGGGTGGGGGTTAAATTGAATACT
CCTACTTGAGCGGTGACGACAGGCATCTCGCAGCCGGTTTCTTCTTTCACTGGATATGCTGTTCTTCCAGTTTGTCCTTTCACTGGACGTGCTTGCTATT
CTTCTTCCATCTCTGTGGTCCTGTGGAGCGCACTGCTCAGGAGGAGTCATGAGCTGGGCTGTCCGAATGCATGTCCATGGATGAGTCGTTTGAAGCCGTG
GGATTAGGCTCGCGGGCTAAGCCGTTTGCAAAGTAGCCTGCATCCCCGCCCTGATCCAGATGGTATGGTTGGAGGCCCCGGCGCACGGGGCTGGATAGTG
CGTTGGAAAAGACCGCCGAGTTCTTGGGCTGCGTCAACCCTGGGTTTCCTAGTGCAAATAAGCTTGCAGATGGTTGATGGTTGCTTGTGTTGGGCATATG
CACAGTANCCTGAGTGCTTTGGCTTGCATATTGTGATCTTGGANAGGCCAACGGATTGTCGCCTCCATACTGAATCTCNT
page-top