Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whei4m06
Contig Information
Length 583 bp
Tissue Dormant seed with water absorption after breaking
Clones 1 Clones [Download: CSV  ,  FASTA ]
whei4m06   
Homology (BLAST) Top Hit hypothetical protein OsI_28114 [Oryza sativa Indica Group]
Score 86
Evalue 0.525462
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>whei4m06
GCCGCCAGCGGTCCATGGGCAAGTCAAGCAAGAAGTCCGCGGCCCCTACTGTCGTGGCGCCGGCGGCCGTCCTTACCAAGGGGAAGGCCGGGAAGAAGCG
CGAAGCCGATGACGAGATCAAGAAGGCTGTAAGCGCAAAGAAACAGAAGGCTGCGCCGGCAAAGGCGGTGCCCGGGCCCAAAGAGGCCGCCAAGAAGGCC
AAGAAGCAGCCGCCGCCCAAGAAGGTTGAGAGCAGCAGCTCTGAGGAGCAGTCATCCGAGTCCGAGGAGGAGGAGGTTCCTAAGAAGACTGCAAAGCCTG
TCAAACACGAGTCTTCAGATGATAGCAGCGACGATTCCTCCTCTGACGAGGAACCTGCAAAGAAGCCTTCTGCTAAACCTGTGACCCCAGCTGCCAGCAA
CGGCTCAAAGAAAGGCAAGCCTGAGAGCAGCTCTTCTAGTTCTGAGGATGAGTCCGATGATGACNAGAAACCTGCTGCTCTGGTAAAGAAAACACCANCC
ATCGAATCTGACAGCTCCGAAAGTGACTCANATGATATCTCANATGANGATGTTCCTGCCAAGACTCCTGCTGCTGCTGCCAA
page-top