Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig58
Contig Information
Length 519 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl50g04    whfl53b04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_015925 [Oryza sativa (japonica cultivar-group)]
Score 289
Evalue 3.56439e-31
Total Hit Count 120
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig58
agtcgcagcgaGGCGGAAGCTAGCAAGCGGCAGCAGCACTTTCCCCACTCCTCTCGCTCCTGTAACCCGAAGGAGGTGGCAAGCCGGCGACCTACTCCAA
TTCAGAGGAGCTGAGCTGTGGGCTGTGGCAAGGGCATAATGCGGGGGGCCCTCGGCCGCGACGCCTCCGCCGGCGGCGCCGGAGGAGGGAAAGGAGGAGA
CGACGCCGCAGCCGGCATCATTCGCCACGACCGCAAGTGCCGGGACCTGCCGTTCCTCGCCCTCTTCGCCGCCTTCTGGGTCGCCATGATTGtcgacTCC
AGCTTCGGGTTCAACCAGGGCAGCCCGCTCAGGCTGACTTATGGACTCGACTACAAAGGGAACATATGTGGCAGCAAACACGGTGATCCAGATTTGAGTG
GAGCTGGATGTTCGTTACTGGGTGAACCCCAACCAAGTGTATCAAAGTGGGCtaaaaaaataGCACAAGTGATCTAGCTGATGCTAAGTCCATCTGTCTG
ATGGAATGCCCCTAtcccg
page-top