Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig49
Contig Information
Length 663 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10d13    rwhdp10d13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit GJ14780 [Drosophila virilis] >gi|194147225|gb|EDW62940.1| GJ14780 [Drosophila virilis]
Score 86
Evalue 0.728843
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig49
CGCCTTCAGGTGCTCCACCAAATTACCAGCCCCATGCACCAAACCCACAGGCAGGCTATGCTGCAGGAGGTGGACCAAACTATCCAAATGCACCACCACC
CCCTGGATACCGAGGTGCCCCAGCCCCTGGCTACCAAGCTGGTAACCAAGGTTACCAGGGTAATCCTGGTGGCAACATGCACAATGGACCAGGCCCAGCC
TACCATAGCAACAACCCTGGATACCAGGGTGGAGCGCCAGGAGGCAACCCGCCGCCACCTTTCGCAGGTGGCAACCAGCCTCCTCCCTACCATGGCGGTG
GTCCTAGCTATGGTGGTGGTGCACCAGACTACCAGGGCCAACCAGGTGGTAACCCAGGCTACCAAGGTGGCGGTAACTACAGCAACGCCGCCCCTCCTCC
CTATGAGGGCAGGGACGGGCCAGGGAGGAACTACCAGTAGAGAAGACTGGTAGAAGAGCGCTGTGTAGGAAGTTAGTAAGAGCTATGCTCGAGTCGCCCT
ATGTTGTTCTCGTGGACTTTTATGCATATATTCTCTATCCATCATGGTGTTTTGAGAACTAGAACTACTGCAAGCTTAGGTAAGAAGTGCTTTGTTTTTT
TCTCTTTGTCGAAATAAATACAATGCTGACTATCGTATGGAACCAGAGCTTTGTTATTGTGCC
page-top