Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig34
Contig Information
Length 210 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10f10    rwhdp10f10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_26354 [Oryza sativa Indica Group] (no hit)
Score 381
Evalue 2.78473e-35
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig34
GCCAGCTAGAGTTTCAGCATTGTAAATCTTGTACTGTTCTATAAAACCTTCACTCTGTCCCTTCTGGACCACATACCACATATCCGTACTCAAAGTTACA
TCTTATTTTTGCTTGTTCTTGCGCTTGTCGTAGAAGTGCAAGAGTGTCGTGTACTTTATATGTAACTTCTAAATTATCATTGTAATTTAGTTTTCCTTAT
AAAAAAAAAA
page-top