Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig33
Contig Information
Length 545 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10e15    rwhdp10e15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_26354 [Oryza sativa Indica Group]
Score 381
Evalue 2.78473e-35
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig33
GCTTGATGAGAAGATATATGTAATGGGTGGTTATGATGCTGATGCTGGAGCAATGGCATCCACCGTTGAGTTGTACGAGCCAAGAATGCCGTCATGGGTG
ATGGTGGAACCAATGAACTACACCAGAGGGTACCACTCTTCAGCTGTGCTCGGTGGTTCGATATTCACTCTGGGTGGGGTCAAAGGTGAAGCAGATACAA
TCTTGGATGTGGTGGAGCGCTACAAGGAAGGCTGTGGTTGGGTGAATACAGGGATGAAGTCAATCGGCAGCAGATGCTACTGCTCTGCCATTGTTCTCTG
ACCGACCGGCTTTCTCTGATCTACGGACACTTCGAACCTATACCTACTAGTATCTAAGTATCTATCTAAGCTGCTGCTGCTGATGAGTGAACTGCAAAGC
AAACTGTTAAGACCCTGGAGGGTCCTCTCTTTGTCTTTGTCTGAATTCAGAAGCCCTTGTCTCTTGAACCGAGAAAACCACTGTCCAGTTTCTCGTTTCT
TGTTTTTTTGGATCTTAATTCACAATGCAGCGAACAAAAAAAAAA
page-top