Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig31
Contig Information
Length 819 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10e12    rwhdp10e12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit innexin, putative [Ixodes scapularis]
Score 88
Evalue 0.648161
Total Hit Count 8
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig31
AATCATCAACCATAGGCGTGGCATGGCGGAGAGCGTCCATGTTAACGTGAAAGAAGATAGCCTCTATGATGGCATGGATGGGCACAAGAGTAAGTATGAC
ATCGAGACGGGTTCCTTGAGCATGAAAGAATACGTGTTATTGATACCAGCTTTGATATGACCCCTTGTGATATAAATACCGAGGTCATTGTTGTTTTGCC
TGAAGCCGGTGTTGTCCAAAAATACGCTACATATACATCGGAATACCTGATGACAAGTTACAACGATGAACAAGAATTACTCGTTATTCCTGTGAAGCAC
ACTACATGGTTCCAGCTAGAAGGGCTGAGAGAGGACAAGAAATTCTACGTGTTTCCAGGCAAAAATGCATGCACGTACAAATATTTTGGAGGGCTTGGTT
TGCATGATACACACGAAGGTTCATGTTCATTAATAGATGATCAAGGCATTAAGGAGAAGGTTGCAGATTTCCTATTTCTATTCTTCCCACACAAAGAGAA
GTTCCAGGCAGAAGCGAGCAGGACGTGTGATGCATGGCGTTTACTTTCCTTGAAAGAAGTCGGTTGGGGTCCACCTGAAGATCGAGATGCACTAGAAGAT
GCATGGCGCACCAATCCAATTAGAGTCCATAATCATCCCGATGGTAGAGTCCAAATTAGGNTAAAGTTTCCTTTTATTTTATTGTTTGGCCGTGTAAGTC
GTATAGGGATATATTTGTTTTTTTTAGACTTGTTATAAGCGTGTGTGCGAGAGGGCAATAGGCCAATTAGTGTCCGGCTATTATATATAGCCTATGGGGC
GTTCATTGTACGGGCAGGT
page-top