Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig26
Contig Information
Length 464 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10a23    rwhdp10a23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_023685 [Oryza sativa (japonica cultivar-group)]
Score 348
Evalue 1.3084e-31
Total Hit Count 205
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig26
CCTCCTTCTCCTCGGGTGCGCACAGTCGTCCACCATGCCGAAGCAGATCCACGAGATCAAGGACTTCCTGCTGACGGCGCGCCGGAAGGACGCGCGGTCG
GTGCGGATCAAGAGGACCAAGGACGCCGTCAAGTTCAAGGTGCGCTGCTCCAGGTACCTCTACACGCTCTGCGTCTTCGACGCCGACAAGGCCAACAAGC
TCAAGCAGTCCCTCCCACCAGGTTTGAGCGTCCAGGAGGTTTAAGCATCAAGCCAGACAATGCCTTTTCTAGTAGCGGGAATGTTCTATCCATCTTGCTT
TAGTAACTGTTAGCAGGCTCTCCTTGTTTACCCCCATTAAGAGAGTTTTGATGTCCCAAGACTGGAATGTAATGTTGGGAGCTATGTGGTTGAACCTGTC
AGGATTTTTGTGTTATTTTCACTTGCTGGAGAAGGAGATCCATTATCTTATCCTAAAAAAAAAA
page-top