Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig3
Contig Information
Length 625 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10d17   
Homology (BLAST) Top Hit hypothetical protein OsI_00313 [Oryza sativa Indica Group]
Score 204
Evalue 1.30265e-14
Total Hit Count 40
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig3
GAGTTTTAATATACAGAGGGGCTACACAAATGATGAGTTCTCGATTCGGAAGTTTTTACTGAGCTTTTTAGACAACTATATATTTATTCAAAAATTAAGA
CAAGCAATTGGAACTGTAATCCAACACTTCATTCACAGGCCTTCCTTCCACCCCCAGCTTGCTGCAACATCGGCAAATGGACTCTCCAGGACCAAATCAG
AAACTCCCCCTCAGGCTCGGCAACACAGGGACGAACATAGTACCGGTTTGATCTTATTTTGGACCCCCACCCCTAATCACAAGTCCAGATGCATGCTTGA
TTTGATCCCGAATGCACAGCTCTAGGATACGCAGCATAACAGAATTCACCAATCCTTCGCTATGAACCACCACGGTTCTGATTCATGTCAGCCTGACCGC
CGGCATCAGGTGCTCCCATGGGCTGCTGATACTGAGGTGGCAATGATGCTGGTGGTGCTCCTGCCTGGGAGTAGAAGACCTGTGCGCGGGGATCAGCAGC
ATACTCGGGGTACCCATAGTTTCCCGCCATGGTCGGCGGAGGCTGCGATGCAGGATGGTGGTGGGATTGCATTACATGGTGGTACCCCATTCCAGCATAA
TTANGGGTCGTGTTANGCCCTGGAG
page-top