Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2167
Contig Information
Length 2127 bp
Tissue Callus
Clones 103 Clones [Download: CSV  ,  FASTA ]
whcs10a14    whcs10a17    whcs10j05    whcs11l22    whcs11n06    whcs12a14    whcs12f15    whcs3m17    whcs4g07    whcs4j09    whcs5o08    whcs6l10    whcs6m04    whcs6n14    whcs7i04    whcs7m03    whcs7o11    whcs8e01    whcs8k01    whcs9k10    whcs9n02    whcs9n11    whcs14a20    whcs14o08    whcs15g05    whcs15i10    whcs15m03    whcs15n19    whcs15o19    whcs16a13    whcs17m14    whcs17n01    whcs18d19    whcs18e18    whcs18p21    whcs19c06    whcs19c15    whcs19i04    whcs19p07    whcs20i03    whcs20i11    whcs1a02    whcs1h10    whcs1h24    whcs2f10    rwhcs10a14    rwhcs10a17    rwhcs10b08    rwhcs10j05    rwhcs10j18    rwhcs11k11    rwhcs11l22    rwhcs11n06    rwhcs12a14    rwhcs12f15    rwhcs12f21    rwhcs12f22    rwhcs3m17    rwhcs3o16    rwhcs4g07    rwhcs4j09    rwhcs5o08    rwhcs6k11    rwhcs6l10    rwhcs6n14    rwhcs7i04    rwhcs7o11    rwhcs8e01    rwhcs8k01    rwhcs9b08    rwhcs9k10    rwhcs9n02    rwhcs9n11    rwhcs13c11    rwhcs13p04    rwhcs14a20    rwhcs14o08    rwhcs15g05    rwhcs15h04    rwhcs15i10    rwhcs15m03    rwhcs15n19    rwhcs16a13    rwhcs17b10    rwhcs17d12    rwhcs17m14    rwhcs17n01    rwhcs18d19    rwhcs18e18    rwhcs18p21    rwhcs19c06    rwhcs19c15    rwhcs19i04    rwhcs19p07    rwhcs20i03    rwhcs20i11    rwhcs1a02    rwhcs1g04    rwhcs1h10    rwhcs1h24    rwhcs1n11    rwhcs2f10    rwhcs2p01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine decarboxylase precursor [Triticum aestivum]
Score 1244
Evalue 0
Total Hit Count 357
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2167
CAACTTGGCACAGAGCTAACACCAATTACAGAAGAGTGCTGCTATGCACACGACATGTTCCAGCCGATTGTTGGACGATACTGCAATTCAGGCCATCGAT
ACCTAGTACTAGGTGCAACACAGCCACTAGATTAAGAATCGTGCTTGAATCGTCCAACAGCTATCGGCTGTGAAGTAGTTTCGATTACAGAACATGAATA
TGATAACAAAGTGACACTCGTCTTAGAAAAAAAATGCTTATTTATCAGTTTGAGACAACTTCTCCCCAGAAGTACGCTCATTGTGGCAGACGCAGTCAAA
CCACCTAGAGCTAATAGTTTATTCGGAGTAGCAATAGCCTGGCCAGCTGCTTCACAGTAACCAAACGACAAACTTAGTCAGAACAAAGTCCACAGACGGA
ACAGCGACAGCCAATCACTCGCACAGCACCGCGCCCTCCTCCAGGGAATCCTCCTCCGCCCGCCATGCGAGGAGGTTGGCGAGCTTGCCTTCCTTGACCA
GAGGGTGGCTCTGCACACTCTCGGCCTCGAAGCAGTGGAAGACGGACCTGGGCGACCCGGCAGAGACAGCAACCTCTTCGTTCGCGGCAAAGCTCTGGTA
GATGAGGACGCCCCCGCAGGGGAGCTCCTGCTCCACAACGTTGTTGCAGTCGTATGCCTCAGCTTCGAGCTTCTTGCCCCAGGTGGCGGCGTGGCCACGG
CCACCGAAGATGGTGACCGCCACAGAGAACTCTGAAGGGCCAAAGCACCGGAGGACCCTCTTGACGATGTCGCCGTAGGCCAGGGCGGAGGCGTCCATGC
CCATGACCTCGTAGCTCGCGTAGCTGAAGCCGTCCTCGGGGGTCACATGGATGGTGGAGACGGCAGATCCCGTTGATGGCGTTCATGGAGTAGCCGCAGG
GCTCGAAGTCGAAGTCACAGACCTCCATCTCAGGGATAATGTCAGAGATTCCAGAGAGCTTGGTCATCTCCTTGGCACAGGAAACGTGGCCATCAGCTTG
AGTCTTGAAGAAGACAGAGGCCTTCTTCTTGTCCAGCCCAGTCATGCACATCTCCAGGGTGACCATGGGCTGCTCAGGTTGCTCGGTGGCATAGTAGATG
TGCCACTTCTGGCCAGGCTTCGCTGGGTCTCCGATCACATAAGCATTGCCACCAGACTTCAGGTGGCCGAAGTAGCGGTTCAGGACATCAACCTCCTCAG
AGAAGCTCCTGTGGGGAGCAGGCTGTGCGCCGGGGAAGATGAACATCCCACGAGAGTACTTGACGGCAGCAAGCGGCATGCACAGCTCTTCAGCAAGCTC
AAGAATCCTAGGAATGGTGAGCAGGAGCATGGTAGTCCCACAGGTCTTGATCACAATCTTCTGAGAATAGATGAACAGGCTGGACTCAGATAGCACATAC
GAGTCGAAGTCCTTGTTGGAGAGCTCGGACACAATGGTGCACCGTGCAAGATCAAGAACAGAGTCAATCTGGGCCCTAGAGAGGGCGCGCAGGCCACGAC
CATGAGGGTCGGCAAAGATCGATGCCTCGGAGAAGGTGATCTCGAGGCGCTTCTCGTAGCCCTCGAACCCGATTGCAGAGGTCGGGGCAGCCATTGTTGC
AGTTTGAGTCAGAAAGCAGAGCAGAGAGGAACAGAGGGAGTAAGACTAGAGAACTGGTCGATTATCGTGAAGCAGGCCAGAGAGATTGGTGGGAGAAAAG
AGTCAGAATAAAATTGCATAAAAATCCTAAACTACGGGAAGGGGATGCCAAAAACGATATCAGGATGGCTTCTTCGCGCAGTTCGAGTATGCAGCAGAGA
ACTTCTTGGCGCCTCCAGCAGGTCGAACGTCTTCAATGCTGTAGCCGAGGGGAGCTTCGTACATCAGGGAACTACTACTGCTAGACTTTTTGCCACCCTT
TGACTCCATTAGCACATTCACTAAAGGTTCCTGGGAAAAATTGTATGGTAACCCCGATCCCGAGCGCGCCCGCTTGTTCCGATTCCGATCTCAAGAATTC
CCCCTCTCCCGACACGAGATCTCGAGCACTCCCAACGAGTTCTGCTCTCTCTTTTTTTCTTATCTAGCTGTGGTGGCGGCGGCGAGACCGGTGGGGGTGG
GAGGAATTCTTGTGCAAGCGAGTTGCG
page-top