Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2166
Contig Information
Length 1878 bp
Tissue Callus
Clones 90 Clones [Download: CSV  ,  FASTA ]
whcs11p11    whcs12a15    whcs12j07    whcs12m16    whcs12n03    whcs3a19    whcs3f14    whcs3i18    whcs3m20    whcs4e14    whcs4n23    whcs4p21    whcs5c18    whcs5h24    whcs6b21    whcs6b22    whcs6i22    whcs6k09    whcs7d07    whcs7e05    whcs8o06    whcs9n14    whcs13c16    whcs13d03    whcs13g12    whcs14b09    whcs14c16    whcs14o18    whcs15c04    whcs15c15    whcs16d20    whcs16f13    whcs16m16    whcs17e12    whcs17h10    whcs17k12    whcs20d01    whcs20f14    whcs20j01    whcs2c16    whcs2f16    whcs2h04    whcs2l20    rwhcs10b18    rwhcs10m01    rwhcs11p11    rwhcs12a15    rwhcs12j07    rwhcs12m16    rwhcs12n03    rwhcs3a19    rwhcs3f14    rwhcs3i18    rwhcs3m20    rwhcs4e14    rwhcs4p21    rwhcs5c18    rwhcs5h24    rwhcs6b21    rwhcs6b22    rwhcs6i22    rwhcs6k09    rwhcs7d07    rwhcs7e05    rwhcs7e17    rwhcs8o06    rwhcs9n14    rwhcs13c16    rwhcs13d03    rwhcs13g12    rwhcs14b09    rwhcs14c16    rwhcs14f10    rwhcs14o18    rwhcs15c04    rwhcs15c15    rwhcs16d20    rwhcs16f13    rwhcs16m16    rwhcs17e12    rwhcs17h10    rwhcs17k12    rwhcs20d01    rwhcs20f14    rwhcs20j01    rwhcs1n07    rwhcs2c16    rwhcs2f16    rwhcs2h04    rwhcs2l20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine decarboxylase [Triticum monococcum]
Score 1156
Evalue 0
Total Hit Count 372
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2166
TAGAAAAAAAATGCTTATTTATAAGTTGAGACAACTTTTCCCCAAACAGTATGCTCATTGTGGCAGACGCAGCAAACCACCTAGAGCTAATAGTTTATTC
AGAGAGCAATAGCCTGGCCGGCTGCTTCACAGTAACCAAACGACAAAAGACATACAGTCAGAGCAAATTCCACAGACTGAACATTCGACAGCAAATCACT
CGCACAGCACCACGCCCTCCTCCAGAGAATCCTCCGCTCGCCATGCGAGGAGGTTGGCGAGCTTGCCTTCCTTGACCAGCGGGTGGCTCTCCACAGTCTC
GGCCTCGAAGCAGTGGAAGACGGACCTGGGCGACCCGGCAGAGACAGCAACCTCTTCGTTCGCGGCAAAGCTCTGGTAGATGAGGACGCCTCCACAGGGG
AGCTCCTGCTCCACAACGTTGTTGCAGTCGTATGCCTCGGCGTCGAGCTTCTTGCCCCAGGTGGCGGCATGGCCGCGGCCACCGAAGATGGTGACCGCCA
CTGAGAACTCTGAAGGGCCAAAGCACCGGAGGACCCTCTTGACGATGTCGCCATAGGCCAGGGCCGAAGCGTCCATGCCCATGACCTCGTAGCTCGCGTA
ACTGAAGCCGTCCTCGGGGGTCACATGGATGGTGGAGAAGGCAGATCCGTTGATGGCGTTCATGGAGTAGCCGCAGGGCTCGAAGTCGAAGTCGCAGACC
TCCATCTCAGGGATGATGTCAGAGATACCAGAGAGCTTGGTCATCTCCTTAGCACAGGAGACATGGCCATCAGCAGAAGTCTTGAAGAACACAGAGGCCT
TCTTCTTGTCGAGCCCAGTCATGCACATCTCCAGGGTGACCATGGGCTGCTCAGGTTGCTCGGTGGCATAGTAGATGTGCCACTTCTGGGCCAGGCTTCG
CTGGGTCTCCAATCACATAGGCATTGCCACCAGACTTCAGGTGGCCAAAGTAGCGGTTCAGGACATCAACCTCCTCAGAGAAGCTCCTGTGGGGAGCAGG
CTGTGCACCGGGGAAGATGAACATCCCCACGGGAGTACTTCACAGCAGCAAGCGGCATGCACAGCTCTTCAGCCAGCTCGAGAATCCTTGGAATGGTGAG
CAGGAGCATGGTAGTCCCACAGGTCTTGATCACAATCTTCTGAGAGTAGATAAACAAGCTCGACTCGGATAGCACGTACGAGTCAAAGTCCTTGTTGGAG
AGCTCGGACACAATGGTGCACCGTGCAAGATCAAGAACAGAGTCAATCTGGGCCCTGGAGAGGGCGCGCAGGCCACGACCATGAGGGTCAGCAAAGATTG
ATGCCTCAGAGAAGGTGATCTCAAGGCGCTTCTCGTAGCCCTCAAATCCGATCGCAGAGGTCGGGGCAGCCATTGTTGCAGTTTTGAGTCAGAAAGCAGA
GCAGAGAGGAACAGATGAAGCAGCAAGCCAGAGAGATTGGTGGGAGAAAAGAGTCAGAATAAAATTGCATAAAAATCCTAAACTACGGGAAGGGGATGCC
AAAAACGATATCAGGATGGCTTCTTCGCGCAGTTCGAGTATGCAGCAGAGAACTTCTTGGCGCCTCCAGCAGGTCGAACGTCTTCAATGCTGTAGCCGAG
GGGAGCTTCGTACATCAGGGAACTACTACTGCTAGACTTTTTGCCACCCTTTGACTCCATTAGCACATTCACTAAAGGTTCCTGGGAAAAATTGTATGGT
AACCCCGATCCCGAGCGCGCCCGCTTGTTCCGATTCCGACCTCAAGAATTCCCCTCTCCCAACACAGATCTCGAGCCCTCCCGACGAGTTCTTCTCTCTC
TTTTTTTCTCTTATCTAGCTGCGGTGGTGACGGCGGCGAGACGGCGAGGGTGGGAGGAATTCTTGTGCAACGAGTAGC
page-top