Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec10a11
Contig Information
Length 217 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec10a11   
Homology (BLAST) Top Hit hydrogen-transporting ATP synthase, rotational mechanism [Zea mays] >gi|195608344|gb|ACG26002.1| hydrogen-transporting ATP synthase, rotational mechanism [Zea mays] >gi|195647528|gb|ACG43232.1| hydrogen-transporting ATP synthase, rotational mechanism [Zea mays] >gi|195658703|gb|ACG48819.1| hydrogen-transporting ATP synthase, rotational mechanism [Zea mays]
Score 275
Evalue 3.81517e-23
Total Hit Count 26
Registered year 2003
Contig Sequence     [ Download ]
>rwhec10a11
ACTCGCGAGGCGCGNGTAGAATAGCTGCTTGGAGAGCTCCTGGCACTTCTCCACGGAGGGAGGCTGCACGACGTACTGCTTGTTCTTCTCCATCGCCTCC
TTGTAGTAGGCGCCGCCGTGCTTCGAGGCGAATTCCGCCGCCTGCGCCGCCTTGGTCCGCAGCTGCGCGAGCCTCGCCGCCATCGCCGCCGGAACCTTGA
CGAAACGTCGGCAAGAG
page-top