Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec10b05
Contig Information
Length 733 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec10b05   
Homology (BLAST) Top Hit hypothetical protein OsJ_004515 [Oryza sativa (japonica cultivar-group)]
Score 758
Evalue 1.07593e-78
Total Hit Count 249
Registered year 2003
Contig Sequence     [ Download ]
>rwhec10b05
GAGCACAACCTCAGTTACACAATGACAGCCAGGCACGCCTAGAATACAAAGAAGCTCACCCAGATAACTGGGAGCATTTCATTTCCGAATGGAAGGGGAG
AGCCAGCAAGCTGGCATTTTTATTGGGTAATCGTTTGATGGCCAGCGCCGGTACCAAACCATTCTATCCAACAATTTTAGCGCCTACAGGTTGGCGGCGG
TCTTGAGGGCATTGCCCTTCTCCTCCAAGCTCGTGAGCAGGCTGTCGAAGCTCCCCTTGAAGGAGCTCACGCCCTCGTGCTCCAGCTGCTTGCCAACCTC
TTCCCAGTCGATGCCCAGCTTCTCCAGGGCACTGTATATGCCCTCAGCTTCTGATACGTTCGCGTCGATTGTCCTAGCAACTGTGCCGTGGTCGATGAAC
GCGTCCAGAGCTTGGTCGGGCATCGTAGAGACGGTGTCAGGTCCGATGAGAGGATCGACGTAAAGAGTGTCCAAGTAAGCCGGGTTCTTCACGCTGGTGG
ATGCCCACAACAACCTCTGCTTCTTGGCTCCCTTCTTCACCAAAGCCTCCCACCTCGGGCCANAGAATTTCTTCAGGTAAAGCTGATTTGCTATCTTTGC
TTGTGCTACGGCAGCCTTTCCCCTCANGGCAAGAGCTTCCGGTGTTCCAATCTTCTCAAGCATTTTGTCNATCANACTGTCAACTCGGCTGACAAANAAG
GATGCTACACTGGTTACTCGGGATAANTCNCTC
page-top