Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec10b06
Contig Information
Length 777 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec10b06   
Homology (BLAST) Top Hit AGAP008482-PA [Anopheles gambiae str. PEST] >gi|157014777|gb|EAA12280.5| AGAP008482-PA [Anopheles gambiae str. PEST]
Score 107
Evalue 0.00367114
Total Hit Count 357
Registered year 2003
Contig Sequence     [ Download ]
>rwhec10b06
GAGCACTACTACTTAACAATGGTCTATTACAGGTTACCATACATATTATTAATTAAATTATGATTCATTCATTCATTCTTCTTCTTCTTCCTTGCGCTCC
AGTCCAGTCCAGAAAATCACCATTGTACAGTAAAGTCCAGAAAATCACCATTATCTTCTTCTTCTCATGATACATTCCTTGTGCTCAGCTCATCTCATCT
CAACTAACCACACATCTTTCTGCAGATCCCAGCTTGTCTTCTCCACCCTCCCCCTCCACAGGAGCAGTCCCTGCTGCAGAGCTCCCCAGTTTCTTATCAG
ATTCAACCTTCTCCACATTCTCTGTACCACTCGCTTCTGCTGCTGCACAACCATTCTTATTAGAAGAGTCAGTTGCGTCTCCTACAGCCTCGACATGCCG
AGGAGGAGCACTCGCTACCTTCTCTGCAGCAGAAGAGCCCAGCTTCTCAGAAGAAGAGTCAGTTGCACCTCCTACAGCCTCGACATGCCGATGAGGAGCA
CTCGCTACCTTCTATGCAGCAGAAGAGCCCAGCTTCTCAGAAGAAGATTCAGTCGCACCTCCTACAGCCTCGACACGCGGAGGAGCACTCGCCGCCTTCT
CTGCAGCAGAAGAGCCCAGCTTATCAGAAGAAGATTCAGTCACACCTCCGGTTTCCACAACAACAGCAGCACCACCCGCTTTTGCCTGCTCTGCAGAAAC
CGGCGCATCTGCAGCAACCCCAGTTTCCTCACCACCCCCTGAAGCAGCCGNCACCACCACACCTTCTTGGCTCTGNG
page-top