Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec10b15
Contig Information
Length 307 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec10b15   
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195605694|gb|ACG24677.1| 30S ribosomal protein S17 [Zea mays] (no hit)
Score 388
Evalue 7.20807e-36
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhec10b15
TGNGTTGAACATGTGATAATCCCAGNGACACACAATATAACCACATACTTTCCATCATACTACATATTTCCCGTTTGCAGCAACTCAACCTTCTTCAATC
ATCNCAGNGGAACACAGGGCATCAACATACTAATACCTATTAGAGCAAAACACACACACACNCACACACACACACACACAANAAGCTACTANTGCCCAGC
ATTACATCCTANTTGATTTGACAAAACNTTTACNCCTTAACAGTCANCTTCACNTTCNGGNAGTTCTATCTCCTTTTANATCGACNTGAAGNCGGANTGN
AAAATAG
page-top