Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec10c10
Contig Information
Length 644 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec10c10   
Homology (BLAST) Top Hit 40S ribosomal protein S21 [Zea mays]
Score 386
Evalue 1.11698e-35
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhec10c10
GNTTTTATCATAGACCATTCATAGGCAAAGCATAAACACCCATAACAGATTCCTCAAAAAAGGTTTAAAGCGGTTTCATAAATATCCATCCTAGCAAAAT
CTGCCACGCGGAACTCATCTACTGCTTGATCTCAGCCCTCTTCTGCTGCCAGAGCCTGTCCAAAGAACCATCGGCATCACCCTGGGCGCGGACGAATCCA
GAGAGGGCAAACGTGGTGAAACTGCCATTATACAGTCCATTCGCATCCACATGCCCGATGTTGATCTGGACAGAGGCATGGTCCTTGGCAGTTATGATCC
TGTTGGTGGCAGAGCACTTCCTTGGGACATAGAGGTCCACCATATCACCCACCTCGTTCTGCATAATGGGGACTGGAGGGATACTGGGACACTGCTCGGT
TAAGGGGGGAGATGGACGGGTGCGGCGGCTGCGGCGGCGGAGCTGTGCCTCGTGCCGAATTCNGCACGAGGCAACCTGTCCGGTGGGCGCAACCCGAGCT
TGGACTATGGTTTCAAGGGCGCCGANATCGCCATGGCCTCNTACTGCTCTGANCTGCANTTCTTGGGCAACCCGGNGACTAACCNTGTCCANANCGCNGA
NCANCACNACCANGATGNNAACTCNCTTGNNCTGATCTCNTNNA
page-top