Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec10c11
Contig Information
Length 519 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec10c11   
Homology (BLAST) Top Hit PREDICTED: similar to parathyroid hormone receptor 1 [Ciona intestinalis]
Score 75
Evalue 7.26494
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>rwhec10c11
GTAGTTTAGTACACACTCGCACAAACCAAACTCTCAAGACATGACATAACATTAAAGTTTAACGACACCGACACTTAGTTTCTCGGGACATAAATTCAGA
AACATGAAATAACAGTGACATGCAGCGTAAAAAGCAGTATTGTTGCCATCCCCCGAACTTATAAACTTCAAGCTTCATTGCTTCTGCTCCAGCGACCAGC
AATAGTTATGCAGAACCGCAACCAACAAAAGAGCACATCATTTTGCTGGGCTAACAGTAGGTTGATAATAGGTGGACGCATTGGGATTCCAGGAAGCACC
GCCTCCCAGTACACCTTTGGTATCTCCTCATAGTTTGGCATCGTCGTTGTGACCGCATTGGCGAAACTCGCAAGCCAGACTCCCTCTCCAGTGACCTCAC
AGCCGGAACAATGGTGGTTGCAGCACTTATATATGCTAGCACACTAAAGCCCATTTGGCACTTCTATATGCTGCCCTACCCTTCTTGTACAGTGCTTCCA
TGTCATTAGCCGCAATCCC
page-top