Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2163
Contig Information
Length 823 bp
Tissue Callus
Clones 56 Clones [Download: CSV  ,  FASTA ]
whcs10c07    whcs10m05    whcs11i05    whcs11k04    whcs11n07    whcs12n05    whcs3a01    whcs3f03    whcs4a03    whcs4m17    whcs4o20    whcs5i15    whcs5n01    whcs6c05    whcs6h09    whcs6h15    whcs6h16    whcs6i11    whcs6i23    whcs7c11    whcs13f04    whcs15k04    whcs15k15    whcs17l19    whcs18c15    whcs19i16    whcs19p11    whcs2k03    whcs2n13    rwhcs10c07    rwhcs10d04    rwhcs10m05    rwhcs11i05    rwhcs11k04    rwhcs11n07    rwhcs12n05    rwhcs3a01    rwhcs3f03    rwhcs4a03    rwhcs4o20    rwhcs5i15    rwhcs6b19    rwhcs6c05    rwhcs6h09    rwhcs6h15    rwhcs6h16    rwhcs6i11    rwhcs7c11    rwhcs13f04    rwhcs15k04    rwhcs17l19    rwhcs18c15    rwhcs19i16    rwhcs1j19    rwhcs2k03    rwhcs2n13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Translationally-controlled tumor protein homolog; Short=TCTP >gi|21070379|gb|AAM34280.1|AF508970_1 translationally controlled tumor protein [Triticum aestivum]
Score 804
Evalue 6.16352e-84
Total Hit Count 335
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2163
CCTCGTGCCGGCCGCTACTCCCCTGCCTCCCCCAGAGCTCGTTAGGGTTTTCTCTTTTTTCGGGGGAGAAATCTCAAGAGGCGGCACCATGCTCGTGTAC
CAGGACAAGCTTTCCGGCGACGAGCTTCTGTCGGATTCGTTCCCTTACAGGGAGCTGGAGAACGGCGTGCTCTGGGAAGTCGATGGCCATTGGGTCGTTC
AAGGAGCAGTTGATGTGGACATTGGAGCCAATCCCTCTGCTGAGGGTGGTGGTGATGATGAGGGTGTTGATGACCAGGCCGTGAAGGTGGTTGACATTGT
TGACACCTTCCGTCTTCAGGAGCAACCTGCTTTTGACAAGAAGCAGTTTATCTCTCACATGAAGCGCTACATCAAGAACCTCTCTGCCAAGCTTGAAGGG
GATGACCTAGATGCTTTCAAGAAGAATGTTGAGTCCGCCACAAAGTATCTTCTTAGCAAGCTCAAGGACCTTCAGTTCTTTGTTGGCGAGAGCATGCATG
ATGATGGCGGCGTGGTGTTCGCCTACTACAAGGAGGGAGCTGCTGATCCAACTTTCCTGTACTTTGCACATGGGCTGAAAGAGGTCAAGTGCTAATCGCA
CTGTATGCTAAAATCTATGCTGTCTTCAGTATTTTTGCTCTTATCTATGGTTGTCAGTCGACTCTCCAATGTTGGTGTCAGTAACTGTCAGATGTTGAGT
GTCTTGAAAACTTTCTGATAATTGTGGGATTTGCTTTGTAATGGTAATCGTGAAATTGGTGTGGTTGTGTTTTGGTTGAATCAAGAGATTCTGCCCTGTT
ATTCTATCGGATTAAAAAAAAAA
page-top