Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec10d14
Contig Information
Length 744 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec10d14   
Homology (BLAST) Top Hit hypothetical protein OsJ_015612 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 91
Evalue 0.187585
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhec10d14
ATTCTTTCACATGGGACTGTTTACAAGTGGCACACACTGTTGGCGCTTTTCNNATAAGCTAGCATGTGAAAAGTAGCAGCACCAGTTACAGTAGAAAAGG
CCATCTAGTTACTGAACTGGTCGTGCATGTACAAAGCACATAAACAGTGAATGTTCAACACCACAGACACCCGAAACATTTTCTCTTCTTCTGCCTCCGA
TGCGCCCTGATCGATCGCTTTATCAAGATAGATATTGCACCCAAGAACTACTACCACAACCCAATCCATCATGAGACCCACTAAACACCATGTGTGGTTT
GAAAAAATTCCGTTTATCAGTAGATTTAGTTTCGAGCAAGCAAGCAAGGTAACTATTTCTAACCCCTCCATATAAGAAAATTGAACGGAGGCTTAATCAG
GGTAACCGAAGTTTTAAAAAAGGTGTTGTGTGTGCTGGATTTATGATGATTTAGGTCTTGGAAGACCTGAACAGGCAATCATAGTATTGCAAGTAAGAAA
ATGTGAAACGTTGCTAATAACGTGCCTCATCTACCAGTAAGGGCTTTATTTTATACCAAAGTTTTAAGCAGCTACAGTTTACAATTCAAACCTATGACTG
CACTCAAAGCTGCAGTGACATTTTTCATCTGGTTCAGCATCCCAATCTAAAGCACACAATAATTTCCTGCAATGGTGAGGCAGCTGAATCAATAACACGC
GGACCAGATCGAGAGTTGAAACTCCACACTACAGGAAAACCAGA
page-top