Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec10e15
Contig Information
Length 722 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec10e15   
Homology (BLAST) Top Hit Os02g0697200 [Oryza sativa (japonica cultivar-group)] >gi|41052947|dbj|BAD07857.1| unknown protein [Oryza sativa Japonica Group] >gi|41053211|dbj|BAD08173.1| unknown protein [Oryza sativa Japonica Group] >gi|113537348|dbj|BAF09731.1| Os02g0697200 [Oryza sativa (japonica cultivar-group)] >gi|215736894|dbj|BAG95823.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765307|dbj|BAG87004.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218191406|gb|EEC73833.1| hypothetical protein OsI_08567 [Oryza sativa Indica Group]
Score 441
Evalue 5.94819e-42
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>rwhec10e15
TCCAATTTTGAGCGACAGGTCATGAACGCGTCATCTTTACCCACTTGGAACTTAGTTGAATAGGCAGGCAACAATTCCTGCCAATCTGAAGGGATTGAGC
TAATCCTTACCTATCCAGACAAGCATTTACTGCAAATTACAGCAAATTCATATTCATATGTAAGAATACCCTAACACTTGCTTGAAAAAGTACTGGCTGG
CATAAAACAGTGGTTGCAGAATTCCATCAGCATGTTCAGTTACATCATAATTTGAGTGCATATTTCAGTTCTTCCCGAAGTGAAAGGGATCCTTGGTGAG
CCACTATATGGCTTTTGGCACTCAATTTTCTCGGGGATTTTTCATCGATTGCTGCATGAGGTACCTGCCAGTGTAGAACCCTGCTGTATACCATGCATTC
AGTACGACAGCGAGATCACTGTTTGCTCCTGTGGTGTCTAAATTCAGGTTCATGCCCACAGTTGTGTTATTCTCCTTTCCAATTCCACCTTCATTTCTCA
TATTTGGAAAGGAGGCAGCATCTCCAGATATTGTATTTCTCATGAAATTCATGGCACCTTCAGCAGTCATCATTGCAGCCTTAGCAACTTGATCATCGCC
AGTAGATACCTTAGTTGGGAGCTGCGTAAAGGCTGAACCAGTAGGATATGTAGTGCTTGCTCCAGGGCAATGATCACAAGTGAATGATATGCTGCAGCCT
CCATTAGGTGGCATACCAGTGG
page-top