Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2160
Contig Information
Length 791 bp
Tissue Callus
Clones 48 Clones [Download: CSV  ,  FASTA ]
whcs10c18    whcs12n02    whcs3d10    whcs9a06    whcs9j05    whcs13b18    whcs13e02    whcs16c14    whcs17h14    whcs18d01    whcs18j05    whcs18j09    whcs18l10    whcs18m13    whcs19a09    whcs19d04    whcs19d15    whcs19h23    whcs19n15    whcs19n16    whcs20j13    whcs20m04    whcs2f13    rwhcs10a18    rwhcs12n02    rwhcs3d10    rwhcs6j23    rwhcs9a06    rwhcs13b18    rwhcs14n24    rwhcs16c14    rwhcs16m03    rwhcs17c02    rwhcs17h14    rwhcs18d01    rwhcs18j05    rwhcs18j09    rwhcs18l10    rwhcs18m13    rwhcs19a09    rwhcs19d04    rwhcs19d15    rwhcs19h23    rwhcs19n15    rwhcs19n16    rwhcs20j13    rwhcs20m04    rwhcs2f13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit translation initiation factor [Triticum aestivum]
Score 513
Evalue 3.18648e-50
Total Hit Count 305
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2160
TTTTTTTTTTAATTTTTTTTTTTTTTTTTTTTTGTAAGAAAGCATATATTATTATTCAACCTTGATGGGAGAGGGTAACAAGCCATCTAACGATGGTGCT
CCTTACAAAGTTTCAACACAAGGGTAACAAGCATACACGCAGAGAGGTGGGCTATGCTAGATTTTCCGTATACTCAGAGCGCGCAAGCTGGTAACGCCTG
CTTGCGCTAGCACACAACTAAATATACTGCACCACCAATATATAGCTGCTTTGCATGTAGACTCTGATATGGAGCTGGCAGTTGTTCAGAAACCATGAAT
CTTGATGTGTTCCTTCTTCACAATGCCGGCCTGGACAAGGAAGTTTGAGACGTTCTTCCTCTGATCACCCTGGAGTTGAATGACCTGTCCAAGTTCTGTG
TCCTGGACAACTGTACCATTGCAGCAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGCTGTAGCTGAACTCCTTCTTCAGGCCCTGGACAGTGGTCAGGC
TCTTGCGACCATTACGCTGCTGGATGCGTACATGAACGTAGTCTTTTGATCCGGCAGCTGCACCAGCGTCCCCAGCATTCGCCTCGGCAAAGGGGTCAAA
GGCAGTTGGGATCTGAACGTCAAGATCAGACATGAAATCTCCTGGTGAGAGTGGCAAAAGCTACACCAAGAACCTGGGAGGCGGTCGAGGAGGAAGAGAT
CAACCAAGAACTTTCCCGGGAGGATTTGGATCGCGGAGAGGCGCTGGCAGTCAGTCCTTGGTGTTCTTCCTCCTCTTTGGGCGGCACGAGG
page-top