Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec10e20
Contig Information
Length 565 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec10e20   
Homology (BLAST) Top Hit Os01g0184800 [Oryza sativa (japonica cultivar-group)] >gi|9558421|dbj|BAB03357.1| putative phosducin-like 3 [Oryza sativa Japonica Group] >gi|113531767|dbj|BAF04150.1| Os01g0184800 [Oryza sativa (japonica cultivar-group)] >gi|215706965|dbj|BAG93425.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215734886|dbj|BAG95608.1| unnamed protein product [Oryza sativa Japonica Group]
Score 658
Evalue 2.29399e-67
Total Hit Count 224
Registered year 2003
Contig Sequence     [ Download ]
>rwhec10e20
GAAAGGAGTAAGTTTTANTCGCTATCATCTTCGCCTTCTCGCGTTTCAAGCTCGGAGACAACCTTTTCTATGAACTTCCTGCGAACGCCTTCCATGACAT
TGTTACCACCTTGCCCATCNTTCAGTACTGGGTCTGAGTGGCAAAGCGCCAATGCAACAGATTCAGGTGTGCATTTCTTTCCACCGAACTTCTGNAGACC
AACATAAGTCCCTTTGACAGCACTGTTGTTGTACACCAGTATTGNAGGAACATTCCTGTCTGGGTAGTTGGGAATACAGNCCGTGGAAATAATTTTANCA
AACTTGGTTTCTGCATATTTTGTCGCCAGTTCCTCCAGGCAAGTCTCAAGCAGCCCACATTCTGGTATCGCATCCTTGTAGAGGAAGACCACAACCCAGA
CGNCCGGTGGAGCCTGCGAAACCTCACGCACAAAATCAGAGCCTGTGATGGGCTGTATTGTGCCGAATCTCGCAGTTTTTGCTGCCTCCTTGAGCTCTGC
AAGCCTCATCCTCCTGTACTGCTCGAGGAAGCGGTCGTCGTCGAGGTCGTCCTCGAGCTCCTCGA
page-top