Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec10f01
Contig Information
Length 747 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec10f01   
Homology (BLAST) Top Hit Os06g0472400 [Oryza sativa (japonica cultivar-group)] >gi|51090410|dbj|BAD35332.1| putative transcriptional regulator [Oryza sativa Japonica Group] >gi|113595663|dbj|BAF19537.1| Os06g0472400 [Oryza sativa (japonica cultivar-group)] >gi|125597215|gb|EAZ36995.1| hypothetical protein OsJ_020478 [Oryza sativa (japonica cultivar-group)]
Score 787
Evalue 4.7685e-82
Total Hit Count 142
Registered year 2003
Contig Sequence     [ Download ]
>rwhec10f01
TATCTCATTGATGGGCATCCTGGTAATGCATGACCGCCTGGACCAACGAGACGGCATGCCACGTCACACACCCTATAGTTTCGTCGGTATCTTTTATTAT
ATGTTCAAACGCACAAGGCACCTTCAGTAACAATTTACATGTGACAACAGCCTGACGAACGCCGGGCGCGCTTCATCCGCCCACCTGGTAAAGCCACCGA
ACCTCATTTCAGAGACATGCGTTTGTACTCCCTCATGGTGTTTGTGATGGCCTGCTCAACCGGCAGCCTCTCCATGCTCGAGGCGCCGTAGAATCCATGG
ACCCGGTTCGTGTTCTTCAGGACAAACTCCGCCTCTCGGGGCCCTGATATGGGACCTCCATGGCAGAGAACGATGATGTCAGGGTTGACGCCGACCGCGG
CATCGGCAATGGCTTGAACCCGGACAATGCTGTCATCTAATGTGGCGGCCGTCTTTGCGCCGATCGATCCAGCTGTTGTGAGGCCCATATGCGCGACTAC
AATGTGCGCTCCGGCCTTGGCCATGGCAGCGCCTTCTTCTGGATTGAAAGCATACGGGGTCGTCAGGAAACCCATGCTGTGAGCCCTTGAGATCATCTCC
ACTTCCATGCATTACGATTTGTGAAGTCACTGAAACAGAATCCATATCCTGTAGCCCATTCCAGTTTCTTCCAAGTTCTGTCTGAAGTTCCCATCAAACA
GACCAACCGTAGGAAAATTTTGGACACCACAAAATCCAATGGCTTCT
page-top