Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2157
Contig Information
Length 2410 bp
Tissue Callus
Clones 46 Clones [Download: CSV  ,  FASTA ]
whcs10c17    whcs10l11    whcs11c02    whcs4a21    whcs4p09    whcs5m15    whcs7c19    whcs7i17    whcs7i18    whcs7j05    whcs7m21    whcs8a02    whcs8n01    whcs14d22    whcs14e07    whcs14l12    whcs15c09    whcs16b10    whcs16n12    whcs18a07    whcs18a19    whcs1d14    whcs2b17    rwhcs11c02    rwhcs4c06    rwhcs5m15    rwhcs6g21    rwhcs7c19    rwhcs7i17    rwhcs7i18    rwhcs7j05    rwhcs7m21    rwhcs8a02    rwhcs8n01    rwhcs14d22    rwhcs14e07    rwhcs14i08    rwhcs15c09    rwhcs16b10    rwhcs16n12    rwhcs18a07    rwhcs18a19    rwhcs18g17    rwhcs1d14    rwhcs2b17    rwhcs2g11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit heat shock protein 90 [Triticum aestivum] >gi|110270510|gb|ABG57076.1| heat shock protein 90 [Triticum aestivum]
Score 3077
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2157
TTTTTTTTTTAGCAGCGAATATAGAAATATAATAACTAACACATATTGTAGAACCAACAATAACGAACTGGTTCCACGAGTACCACAAACAGCTAACCGC
GCTTAATGTTTGGCCAGCCAAAAGACAAAACCGATACAGCTAAAACGTGCCAAAACCATCCAACGTCGACACTAAGATAAAAACAACTAGGCGGTGCAGG
GCATGGACATCTGACGACGACAGCCGACAGGCAGCCTTGGCGCTTAGTCGACCTCCTCCATCTTGCTCTCGCCGGCGTCGTCCTCCAGGGGCGGCATGTC
GGTGTCGTTCTCTGGCGCCTCGTCATCCTCATCAATGCTCAGGCCAAGCTTGAGCATGCGGTGGATCCTGGTGCCGAAGGTGTTGGGGTCCTCCAGGCTG
AAGCCGGAGGTGAGCAGGGAGGTCTCGAAGAGCAGCATCACGAGGTCCTTGACAGACTTGTCGTTCTTGTCGGCATCGGCACGCTTACGGAGCTCGTCCA
TGATGGCGTTCTCAGGGTTGATCTCCATGGTCTTCTTGCTCGACATGTAGCCAGCCATGCTCGAGTCCCTTAAGGCCTGGGCCTTCATGATCCTCTCCAT
GTTGGCGGTCCACCCATATTCGCCAGTCACCAGACAGCAAGGGGAGTCCACCACACGGTCAGAGACGATAACCTTCTCAACCTTGTCGCCCAGCACCTCC
TTGATGACCTTGCACAGCCCCTCAAACTTCTCCTTGAGCTCCTCCTGCTTCTTCTTCTCGTCCTCGCTCTCATCAAGCTTCAGACCCTCCTTGGTGGCAG
AGACAAGCTTCTTGCCCTCAAACTCCTTGAGCTGACCAATGGCATACTCATCAATGGCGTCAACCATGTAGATGACCTCATAGCCCTTCTTCTTCAGCTT
CTCAAGGAAGGGAGAGTTCTCCACAGCCTTCTTGCTCTCACCAGTGATGTAGTAGATCTCGTTCTGTCCCTCCTTCATCCTGGTCACATAGTCCTTGAGG
CTCGTCAGCTCATCACCACTCTTGGTGGAGTGGTACCTCAGAAGCTCAGCAATCTTGGTCCTGTTCTGGGAGTCCTCGTGGATGCCAAGCTTGAGGTTCT
TGGAGAAGGCCTCGTAGAACTTGTTGTAGTCCTCCTTGTTCTCAGCAATCTCAAAGAAGAGCTCAATGCACTTCTTGACAAGGTTCTTCCTGATGACCTT
GAGGATCTTGTTCTGTTGGAGAGTCTCACGGGAGATGTTCAGGGGAAGGTCCTCTGAATCAACAATGCCCTTGACAAAGCTCAGGTACTCAGGGATCAAC
TCCTCACAGTTATCCATGATGAAGACACGGCGCACGTACAGCTTGATGTTGTTGGCCTTCTTCTTGTTGTCGAAGAGGTCGAAGGGGGCCCTCTTGGGCA
CAAACAGGACAGCCTTGAACTCAAGCTGACCCTCAACAGAGAAGTGCTTGACAGCCAAATGCTCCTCCCAGTCATTGGTCAAGCTCTTGTAGAAAGCAGC
GTACTCTTCCTTGTTGATCTCCTCTGGCTTCCTCATCCAGATCGGCTTCTGCTTGTTGACCAAGTTCCACTCGTGAGAGACTTCCTTGATCTTCTTTTTC
TTCTTTTCCTTCTCTTCCTTCTCCTCATCAACATCCTCAACCTTGCCCTCCTCAGTATCCTTCTTCTCCTCCTCATCTTCATCGTCAGAAATTTCCTTCT
CAGTGGTCTTCTCGGTCCACAGGGAGATGGGGTAGCTGATAAACTCAGAGTGCTTCTTAACTAGATCCTTGATGCGGCGCTCCTCAAGGTATTCCATCTG
GTCGTCCTTGAGGTAGAGCACCATCTTGGTACCCCTGCCGAGCTGCTCCCCAGACGTATCACGAGTGACGGTGAAGGAGCCACCGGCCTGAGACTCCCAC
ACGTACTGCTCGTCGTCGTTGTGCTTGGTGGTGACGACGACCCTCTCGGCGACGAGGTAGGCGGAGTAGAACCCAACACCGAACTGCCCAATCATGGACA
CGTCAGCGCCGGCAGCGAGTGCCTCCATGAACTCCTTGGTCCCCGACCTGGCGATGGTCCCGAGGTTGTTGACGAGGTCCGACTTGGTCATGCCAATGCC
GCTGTCGACGATCGTGAGCGTGCTGGTCGCCTTGTCGGGGATGATGTGGATGAAGAGCTCGGGCTGCGCATCGAGCTTGCTCTTGTCCGTGAGGCTCTCG
AACCTGATCTTGTCCAAGGCATCGGAGGAGTTGGAGATGAGCTCGCGGAGGAAGATCTCCTTGTTGGAGTAGAAGGTGTTGATGATGAGCGAGAGGAGCT
GGTTGATCTCGGCCTGGAAGGCGAAGGTCTCGGTCTCCGTCGCCATGGCTGCGCGCGTCCCTGAGCTGCTCGAGGCGGAGGAGAAGCGTGCGGGAGGCGG
CTAGGGTAGG
page-top