Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec10g02
Contig Information
Length 767 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec10g02   
Homology (BLAST) Top Hit hypothetical protein OsI_09521 [Oryza sativa Indica Group]
Score 649
Evalue 5.07976e-66
Total Hit Count 113
Registered year 2003
Contig Sequence     [ Download ]
>rwhec10g02
GCAAGAGTACAAGCGCGATAACTACGGAATTACAGAGTTCAGAGGGCTTACAAACTACCACAAAGGTGACATACATCTCTTTTTCTCAACTACGACATGA
AGCGAACAAAACCAGGCAAAGACATCCCCAGTTCTTCAATGATCTGCATGCGCTCATCAGCGTTCCGTGGATATCTGGATGGGCACTTCATCTTGGGATC
CAAGTCACCACAGCGCAGACATACCTTCCTGTCATGCAGACATATCTCCGCCATATGAACCGCATGTTCCATGACACACCTGATGAATCGCACAAAGATG
TCGTCAGGTTGGAAGCCATAGATGGTGAGCTTAACCAGATTCTTGTGCTTGAAAGCAGGGGCATGTGGCTTCCACTCCACGTCTGCCTTTTCACAGTAGC
CATTTCTCTCCCGAAACTCTTTGTCTCTCATCACCATATGGCACCAATGATCCCATACTGTAATGCACAGCTCTTTGAGGGACGGTGCAGCTTCAAGAAT
AAACATTGTCCAAGCTAAATCACATTCTTCAGGAAGTTTGTCCAGAATCACATGCTGTAGTTTGCTGAGCACAGGCCTAAGCAGCTCCGGGCTTTCTGGT
AGAACCCAAATCTTTTCACTTTCAAAATCCAGATGCAGATCGCTTATGGAAGGAACATTACCGAGGAGCTGACTTAACTCAAGAGTCCTAGTCGATCTGG
AGCCAGTTTTAGCAAGCCTCANCTTTGAAAGCTGTGGCACAAAACCAAAATACAGGGGATCTTTCTC
page-top