Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2155
Contig Information
Length 1609 bp
Tissue Callus
Clones 40 Clones [Download: CSV  ,  FASTA ]
whcs10a01    whcs10a02    whcs10i14    whcs11i03    whcs11m17    whcs12n06    whcs5a09    whcs5e15    whcs5n18    whcs6f08    whcs6j24    whcs9a19    whcs9d05    whcs9j03    whcs9p17    whcs14m12    whcs15l20    whcs19b01    whcs19j18    whcs20b14    whcs20g19    whcs20i22    rwhcs10a01    rwhcs10a02    rwhcs10i14    rwhcs11m17    rwhcs12n06    rwhcs5a09    rwhcs5n18    rwhcs6f08    rwhcs9a19    rwhcs9d05    rwhcs9j03    rwhcs9p17    rwhcs14m12    rwhcs15l20    rwhcs19b01    rwhcs20b14    rwhcs20g19    rwhcs20i22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha tubulin-2A [Triticum aestivum] >gi|90289598|gb|ABD92931.1| alpha tubulin-2D [Triticum aestivum] >gi|90289600|gb|ABD92932.1| alpha tubulin-2B [Triticum aestivum]
Score 2174
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2155
GGTTCAAACATACAAGGGTTCTTACAACACAACAGGTTGTAAAACAAACACCACAAAGCAAATGTTCAAACAGACAGATAACAGATAAAGCCACTCGGGC
AGATCATAGGATTGCAGCAGCATGCCTTGGGAAAGCACCAGGAGGCAGGCTCTAGTACTCGTCGCCCTCGTCACCGTCCTCACCCTCGTCAAACTCAGCA
CCAACTTCTTCATAGTCCTTCTCCAGGGCAGCAAGATCCTCACGGGCCTCAGAGAACTCTCCCTCCTCCATGCCCTCACCCACGTACCAGTGGACGAAGG
CGCGCTTGGCGTACATCAGGTCAAACTTGTGGTCGATGCGGGAGAAGACCTCGACGACACTGGTGGAGTTGGAGATCATGCACACAGCCCTCTGGACCTT
GGCAAGGTCACCGCCTGGGACAACACCAGGTGGCTGGTAGTTGATACCACACTTGAAGCCAGTGGGGCACCAGTCAACAAACTGGATAGTGCGCTTGGTC
TTGATGGTGGCCACAGCAGCGTTGACATCCTTGGGCACAACATCACCACGGTACATGAGGCAGCAGGCCATGTACTTGCCGTGGCGGGGGTCACACTTGG
CCATCATGGAGGAAGGCTCAAAGGCGCTGTTGGTGATCTCAGCAACAGACAGCTGCTCATGGTAGGCCTTCTCGGCTGAGATCACTGGGGCATAGGAGGA
AAGCATGAAGTGGATCCTCGGGTAGGGCACCAGGTTGGTCTGGAACTCGTTGACATCAACATTCAGAGCACCATCAAACCTCAGGGAAGCAGTCAATGAT
GAAATGACCTGAGAAACAAGCCTGTTGAGGTTGGTGTATGTTGGGCGCTCAATGTCAAGGGAGCGGCGGCAGATGTCATAGATGGCCTCATTGTCAAGAA
GGATAGAGACATCGGTGTGCTCAAGGAGTGAGTGGGTGGACAGGACACTGTTGTATGGCTCAACAACAGAAGTGGAGACCTGGGGAGATGGGTAAACTGT
GAACCCAAGCTTGGACTTCTTTCCATAGTCAACAGAGAGACGCTCCAGGAGAAGCGAACCAAGGCCAGAGCCAGTTCCACCTCCAACAGCGTTGAAGACA
AGGAATCCCTGCAGACCAGTGCAGTTGTCTGAAAGCTTCCTGATACGATCAAGGCAGAGATCAACAATCTCCTTGCCAATGGTGTAATGACCACGGGCGA
AGTTGTTGGCTGCATCCTCCTTGCCACTGATAAGCTGCTCAGGGTGGAAGAGCTGGCGGTAAGCGCCAGTCCTCACCTCATCAATCACAGTGGGCTCGAG
ATCTACGAAGACAGCACGGGGGACGTGCTTCCCAGCACCAGTCTCGCTGAAGAAGGTGTTGAAAGCATCATCACCTCCCCCAACGGTCTTGTCACCGGGC
ATCTGGCCATCAGGCTGAATGCCATGCTCGAGGCAGTAGAGCTCCCAGCACGCGTTCCCGACCTGGATGCCGGCCTGGCCGATGTGGATCGAGATGCACT
CCCTCATGGCGGCGGGTGGGGGTGGTTGGTGGGCTGCGCCGCTGGCGAAATGGGGAGGACGAGGGCGAAGGCTCGGTTGCGCGGAGAGAGGCGAGTACGA
AGACGCCTT
page-top