Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2148
Contig Information
Length 1048 bp
Tissue Callus
Clones 27 Clones [Download: CSV  ,  FASTA ]
whcs10a04    whcs4p07    whcs7b23    whcs8p10    whcs9m22    whcs9o09    whcs14n20    whcs15d14    whcs17g14    whcs17h01    whcs17h02    whcs1o21    whcs2j22    rwhcs10a04    rwhcs6f10    rwhcs7b23    rwhcs8p10    rwhcs9m22    rwhcs14m18    rwhcs14n20    rwhcs15d14    rwhcs17g14    rwhcs17h01    rwhcs17h02    rwhcs20e17    rwhcs1o21    rwhcs2j22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein [Bromus inermis]
Score 1221
Evalue 4.06316e-132
Total Hit Count 433
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2148
TTTTTTTTTTAACCGGATGAGGTCTCGAAATAGCGCTTAATAAGGTAAACATCCACATTACATCTAGCAGCAACCACGAGTTCGCAAATCAACAAACATC
AGGCAAAACTTAAAAACGATGGTTCCAGGAACATAGGTCTATATCCTTGCAGATAACTGGCTATAGCAAAACGACTCAACACCTCAGAATCAGGCCTTGG
CAGCAGCCTGGGCAGCGGCATCCCGCTTCCTCTGCTCCTCAATGATGGTGAGCTTGATACCCTTGCCCTTGGGGAGGCTCACCCACGGCTTGGTGCCCTT
GCCGATGGTGAACACGTTGCCCAGACGGGTGGCGAACTGGTGGCCCTGGGCATCCTCAACGTGGATGGTCTCAAAGGTTCCCTTATGCTTCTCCCTGTTC
TTGATCACACCAACACGCCCAGTGTTGCGCCCACCAGTCACCATGACCACGTTGCCGACGTCAAACTTGATGAAGTCAACAATCTTGTTGGTCTCCAGGT
CAAGCTTGATGGTGTCATTGGCCTTGATGAGTGGGTCTGGGTAGCGGATGGTGCGGCCATCATAGGTGTTGAGGTATGGGATGCCCTTCTGGCCAAACTG
GACAGACCTGACCTTGCAGAGCTTGAACTTAGCATCCTCGTCCCTGACAGAGTGAAGGCGGAAGCGACCCTTGGTGTCATACAGAAGCCTGTAGTTCTCA
CCAGTCTTGGGAATGGAAATGATGTCCATGAAACCAGCAGGGTAGGTCTTGTCAGTGCGGACCTTTCCATCAACCATAATATGACGCTGCATAAGGATAG
ATTGCACTTCACGGTAGGTGAGAGCATATTTCAGTCTGTTCCTCAGGATGAGGATCAGAGGCAGGCACTCCCTGGCCTTGTGAGGACCGGATGATGGCTT
GGGGGCAAAAGCTCCACCAAGCTTGTCAAGCATCCAATGAGACGGGGCATTGAGCCTCTTCAGATGCTTCTTCAAACCCCTAGCCATGGTTGCGAGCTCG
GGCTAGGTCGCCGTGCTTCTCCTCTTCGGGCACCGCCGCCGCCTGCTC
page-top