Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2146
Contig Information
Length 1580 bp
Tissue Callus
Clones 27 Clones [Download: CSV  ,  FASTA ]
whcs10e10    whcs11l04    whcs11m22    whcs12g18    whcs6f02    whcs7a02    whcs7i09    whcs13g06    whcs16c01    whcs16l06    whcs18o16    whcs2c01    whcs2e06    whcs2e20    rwhcs10e10    rwhcs11l04    rwhcs12g18    rwhcs7a02    rwhcs7i09    rwhcs13g06    rwhcs16c01    rwhcs16l06    rwhcs18o16    rwhcs1d15    rwhcs2c01    rwhcs2e06    rwhcs2e20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 2191
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2146
GCCGCCGCCTCCTCTCGGTTCCTTCTCCTTCCTCGGAGCTTCAGCCATGGGTAAAGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGCTCGACTC
TGGCAAGTCGACCACCACTGGCCATCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAAGCCGCCGAGATGAACAAG
AGGTCTTTCAAGTACGCCTGGGTGCTTGACAAGCTGAAGGCCGAGCGTGAGAGGGGTATCACCATTGATATTGCCCTGTGGAAGTTCGAGACCACCAAGT
ACTACTGCACCGTCATTGATGCTCCTGGTCACCGTGACTTCATCAAGAACATGATTACTGGTACCTCCCAGGCTGACTGTGCTGTGCTCATCATTGACTC
CACCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGC
TGTAACAAGATGGACGCCACCACTCCCAAGTACTCAAAGGCCCGTTATGAGGAAATTGTCAAGGAAGTCTCTTCGTACCTGAAGAAGGTCGGCTACAACC
CTGACAAGGTTCCCTTTGTTCCCATCTCTGGGTTTGAGGGTGACAACATGATTGAGAGGTCCACCAACCTTGACTGGTACAAGGGCCCTACCCTTCTTGA
GGCTCTTGACCAGATCAACGAGCCCAAGAGGCCCTCAGACAAGCCCCTGCGTCTTCCCCTTCAGGACGTTTACAAGATTGGTGGCATTGGAACTGTGCCT
GTTGGCCGTGTTGAGACTGGTGTCATCAAGCCTGGTATGGTTGTTACCTTTGGTCCCACTGGTCTGACAACTGAGGTCAAGTCCGTTGAGATGCACCACG
AGTCCCTCCTGGAGGCGCTTCCTGGTGACAATGTTGGCTTCAACGTGAAGAACGTTGCTGTTAAGGATCTGAAGCGTGGGTTTGTTGCATCCAACTCCAA
GGATGACCCTGCCAAGGAGGCAGCCAACTTCACCTCCCAGGTCATCATCATGAACCACCCTGGTCAGATCGGCAACGGCTACGCCCCAGTGCTGGACTGC
CACACCTCCCACATTGCTGTGAAGTTTGCTGAGCTGGTGACTAAGATCGACAGGCGATCTGGTAAGGAGCTGGAGGCGCTGCCCAAGTTCCTGAAGAACG
GTGACGCTGGTATCGTGAAGATGATTCCCACCAAGCCCATGGTTGTGGAGACCTTCGCCACCTACCCTCCTCTTGGCCGCTTCGCTGTGCGTGACATGAG
ACAAACGGTTGCTGTTGGTGTCATCAAGGGCGTGGAGAAGAAGGACCCCACCGGCGCCAAGGTTACCAAGGCTGCCATCAAGAAGAAATAGGCATCTATC
TAGCAGAAGGTTTTTGTTCATGGTCATTGCTTTTGTTGCTGCAGACTCTTATCCCGGGCGAGCAATGATCCTGTCTGTCGTTTAATTACTGTATTTCTAT
TCCTGCTTCGGCTAAACTCCTGTGCCTTGAGACTGATCTGTTGTGAAATGCAAGTTATTAGATTGCAACTAAAAAAAAAA
page-top