Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2132
Contig Information
Length 933 bp
Tissue Callus
Clones 20 Clones [Download: CSV  ,  FASTA ]
whcs10d07    whcs6g08    whcs6h22    whcs14b14    whcs17o04    whcs17o16    whcs17p03    whcs17p04    whcs17p15    rwhcs10d07    rwhcs6g08    rwhcs7m01    rwhcs14b14    rwhcs14d04    rwhcs17m16    rwhcs17o04    rwhcs17o16    rwhcs17p03    rwhcs17p04    rwhcs17p15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0612800 [Oryza sativa (japonica cultivar-group)] >gi|158513163|sp|A2YEZ6|SAP8_ORYSI RecName: Full=Zinc finger A20 and AN1 domain-containing stress-associated protein 8; Short=OsSAP8; AltName: Full=Stress-associated protein 3 >gi|158513350|sp|A3BDI8|SAP8_ORYSJ RecName: Full=Zinc finger A20 and AN1 domain-containing stress-associated protein 8; Short=OsSAP8; AltName: Full=Stress-associated protein 3 >gi|51090916|dbj|BAD35521.1| putative multiple stress-responsive zinc-finger protein [Oryza sativa Japonica Group] >gi|51090950|dbj|BAD35553.1| putative multiple stress-responsive zinc-finger protein [Oryza sativa Japonica Group] >gi|113596106|dbj|BAF19980.1| Os06g0612800 [Oryza sativa (japonica cultivar-group)] >gi|125597847|gb|EAZ37627.1| hypothetical protein OsJ_021110 [Oryza sativa (japonica cultivar-group)] >gi|215679046|dbj|BAG96476.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215697574|dbj|BAG91568.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737658|dbj|BAG96788.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737696|dbj|BAG96826.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765570|dbj|BAG87267.1| unnamed protein product [Oryza sativa Japonica Group]
Score 747
Evalue 3.11594e-77
Total Hit Count 420
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2132
GACAGACAGACAGACACCGGGAGGAAACAGCAGTACATTACAGAGTGCTAGCCAAAATGCGAAAGCCACAATACCGTTCCCGTTCCGCCGCGCAGAGAGA
CGACCATAAATAAAGCTTACACAACATAGCCAACAAGGAGACCGTTCGGACCTGGGGCTGCCGCCGAGGCGCGTGTGCCATGCATCACGATTGCCCAACA
ACTAAGATTGCAGAAGCCAACATGATGAAAGGATAATGCAGCAAGACGCACGATGACGAGGTAGCGCAGATTTGATTTGGGACCTTATGTTCTGCCGACC
GTAGGGGGGACCCTTCCTAGATCTTGTCAAGCTTCTCCGCCTTCACCACTGGGTTGGCCTTGGCGATGGCGTCCATGGCCGCGGCGCGGTAGTCAAACTT
GCACTCGTGCTTGTCCGAGTAACGGTGCGTTGCGCAGTACAGGTTCCCACACCGGCAGTTGAATCCGGTCAGCCCGACCCTCTTTCTGCAGGTGCTGCAC
CGGCTTGGGCCTTTGGGGTTCTCCATCGCCCCCTCGCTTGGACCAGCGATATCAGCAGGCTGTGCGGTAATAAGCGTCTTCGCCTCAACGTGAGCAACTG
CCACCGCCGTGCTGCCAGCAGCAAGATGTTCTTTCGCGGCATCGCCACCGTTGACGATGCTGTCGAAAGAGGAGGCGGCCAGCTTTGCCTGCTCCTGCTT
CATCGCCATCTCCTTGTGGCACTTGGAGCACATGTTCATGGTCGCCGCGCTGCCGAAGAAGCCACAATTATTGACGCAAAGGATGGGGCCCTCCCGAGAC
TGGCAGCCGGTCTCCTTGTGCTCCATGGCTTTGATTTAACTGATAGGAGGAAGCCCTCGTCGCGATTCCTCTCCGGCGATCCCCTAGGAGGGGGAGGACG
AGGAGGCGAGGGGAGAGGAATCGCGAGGAATTC
page-top